View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_low_42 (Length: 297)
Name: NF16566_low_42
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 21 - 284
Target Start/End: Original strand, 22792817 - 22793080
Alignment:
| Q |
21 |
cgtcagtttccaacgaacctggctccgctgcagcacaacgagcagcggagtgggggttagtgttgaaaactgattcggagacggggaagccacaaggagt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792817 |
cgtcagtttccaacgaacctggctccgctgcagcacaacgagcagcagagtgggggttagtgttgaaaactgattcggagacggggaagccacaaggagt |
22792916 |
T |
 |
| Q |
121 |
ggcagttagaagctctggtggtggttcaaggagggactcgaacaattcaatgaaaagttccggtgaaagttccgatgacggaagggagtttagaggaatc |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22792917 |
ggcagttagaagctccggtggtggttcaaggagggactcgaacaattcaatgagaagttccggtgaaagttccgatgagggaagggagtttagaggaatc |
22793016 |
T |
 |
| Q |
221 |
ccgagagtttcagaggatttgagagatgctctatcagcatttcaacagacatttgttgtctctg |
284 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22793017 |
ccaagagtttcggaggatttgagagatgctctatcagcatttcaacagacatttgttgtttctg |
22793080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 267
Target Start/End: Original strand, 40954528 - 40954574
Alignment:
| Q |
221 |
ccgagagtttcagaggatttgagagatgctctatcagcatttcaaca |
267 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
40954528 |
ccgagagtttcagaggatttgaaagatgctttatcagcttttcaaca |
40954574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University