View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_low_45 (Length: 290)
Name: NF16566_low_45
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 119 - 274
Target Start/End: Original strand, 19065661 - 19065815
Alignment:
| Q |
119 |
tttggcttattgtgaggataataggtcatcaacatatattgagacatttagggttcaattgggacatgtttacaaaaagcggtaagaaggttttttacac |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
19065661 |
tttggcttattgtgaggataataggccatcaacatatattgagacatttagggttcaattgggacatgtttacataaagaggtaagaaggttttttacac |
19065760 |
T |
 |
| Q |
219 |
aatgattactaaaaagtgattataatgtttaataatttcttttacacctaaatatt |
274 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
19065761 |
aatgattactaaaaggtgcttataatgtttaataatttc-tttacacttaaatatt |
19065815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 19065560 - 19065607
Alignment:
| Q |
5 |
taagagtagattgtaactaactataaatacaatcaatagctatttata |
52 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
19065560 |
taagagtagattgtaactaactataaacacaatcaatagctatatata |
19065607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University