View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16566_low_53 (Length: 250)
Name: NF16566_low_53
Description: NF16566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16566_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 33410922 - 33410687
Alignment:
| Q |
1 |
taagcacctaatcattgttggctgtttcatcagattgcctgttttgtcttcagttgatcagcacctgtttatagaaacctggctataagcataacannnn |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33410922 |
taagcacctaatcattgttggttgtttcatcagattgtctgttttgtcttcagttgatcagcacctgtttatagaaacctggctataagcattacatttt |
33410823 |
T |
 |
| Q |
101 |
nnnatgtgtattctccttttctatattatagtagttaacttagtaaaggttttcatgaattatattggtgattcagtaaataatattgttatattggtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33410822 |
tttatgtgtattctccttttctatattatagtagttaacttagtaaaggttttcatgaattatattggtgattcagtaaataatattgttatattgatga |
33410723 |
T |
 |
| Q |
201 |
agtcaatgttttgagacataaaatcaggatcgtata |
236 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33410722 |
agtcaatgttttaagacataaaatcaggatcgtata |
33410687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University