View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16567_low_5 (Length: 233)
Name: NF16567_low_5
Description: NF16567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16567_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 47873412 - 47873216
Alignment:
| Q |
11 |
agattattctgcctcagtggcttacacttcgtaaccacatataataatgtgatccatgggtgaagttgatgaacatgctttttaagtttggtgtggtggt |
110 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47873412 |
agattcttctgcctcggtggcttacacttcgtaaccacatataataatgtgatccatgggtgaagttgatgaacatgctttttaagtttggtgtggtggt |
47873313 |
T |
 |
| Q |
111 |
gacatccactggtcattatttgacagttaagtgtgtagttttccttttgcagttatgttatgtgtaaagatcatttgaacttttgtgcgtgcgtgcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47873312 |
gacatccactggtcattatttgacagttaagtgtgtagttttccttttgcagttatgttatgtgtaaagatcatttgaacttttgtgcgtgcgtgcg |
47873216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University