View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16567_low_6 (Length: 226)
Name: NF16567_low_6
Description: NF16567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16567_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 46915010 - 46914803
Alignment:
| Q |
1 |
atcatctacctccactgccctatgttttgttctattttgggatgagccaaacttgattctcattgtgtagaattgattgatatgtttgaatgttttgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46915010 |
atcatctacctccactgccctatgttttgttctattttgggatgagccaaacttgattctcattgtgtagaattgattgatatgtttgaatgttttgggt |
46914911 |
T |
 |
| Q |
101 |
agaattcaagagcatatagttgaaagcaaaatctccaaattaaatttacatcattgcttgggtttatgtaaagagttggtaacttttattttcttacttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914910 |
agaattcaagagcatatagttgaaagcaaaatctcca-----aatttacatcattgcttgggtttatgtaaagagttggtaacttttattttcttacttt |
46914816 |
T |
 |
| Q |
201 |
tttaacctttgct |
213 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
46914815 |
tttaacccttgct |
46914803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University