View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16568_high_6 (Length: 206)
Name: NF16568_high_6
Description: NF16568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16568_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 129
Target Start/End: Complemental strand, 1792342 - 1792234
Alignment:
| Q |
17 |
aatgagaagcgtacttagagagatgtgggattgtaaagacttgagtacttacttttaaaggcaaagatgattggtggtcaaaggaaagaagcttgttaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792342 |
aatgagaagcgtacttagagagatgtgggattgtagagacttgagtactt----ttaaaggcaaagatgattggtggtcaaaggaaagaagcttgttaag |
1792247 |
T |
 |
| Q |
117 |
acgattttttgag |
129 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
1792246 |
acaattttttgag |
1792234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 121 - 195
Target Start/End: Complemental strand, 1791842 - 1791768
Alignment:
| Q |
121 |
ttttttgagtgaaaactcattttcaatctttaagaaaattgcatatatgaaatagaaaactgcatatagtataat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1791842 |
ttttttgagtgaaaactcattttcaatctttaagaaaactgcatatatgaaatagaaaactgcatatattataat |
1791768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University