View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16568_low_9 (Length: 266)
Name: NF16568_low_9
Description: NF16568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16568_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 37814159 - 37813922
Alignment:
| Q |
13 |
aaaataaaaacttatcctttgttccaattacttccaacccaaaggacaaaaataataagcaaataaaaagtgaccatgatattaagaagatggttcatag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37814159 |
aaaataaaaacttatcctttgttccaattacttccaacccaaaggacaaaaataataagcaaataaaaagtgaccatgatattaagaagatggttcatag |
37814060 |
T |
 |
| Q |
113 |
catcaaagtaggaatctcacttgttttggtatcacttctttacattttgaatcctctctttgatcaagttggtgaaaatgcaatgtgggctatcatgact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37814059 |
catcaaagtaggaatctcacttgttttggtatcacttctttacattttgaatcctctctttgatcaagttggtgaaaatgcaatgtgggctatcatgact |
37813960 |
T |
 |
| Q |
213 |
gttgttgtcatctctgaattcaatgcaggtatatactt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37813959 |
gttgttgtcatctctgaattcaatgcaggtatatactt |
37813922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University