View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_109 (Length: 215)
Name: NF16569_high_109
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 42 - 119
Target Start/End: Original strand, 5179488 - 5179566
Alignment:
| Q |
42 |
ctaacccaattaactaacaaggtactaattaatgaacgtctaattatgttttccttttcaaaagtatggt-ctaattaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5179488 |
ctaacccaattaactaacaaggtactaattaatgaacgtctaattatgttttccttttcaaaagtatggtactaattaa |
5179566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University