View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_119 (Length: 204)
Name: NF16569_high_119
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_119 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 33751166 - 33751369
Alignment:
| Q |
1 |
taggtgaagctagctataccaatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751166 |
taggtgaagctagctataccaatgattgatgattgatgaatttgtttcattttttaattgtagcatctctcttttatgttttattgtggtggaagatgga |
33751265 |
T |
|
| Q |
101 |
tgttatatctaaagatnnnnnnncttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccataggatttggtcatgatc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33751266 |
tgttatatctaaagataaaaaaacttaatttagactgatttcatcaaattgatttttgtaattcttggattgatgtgaaccaaaggatttggtcatgatc |
33751365 |
T |
|
| Q |
201 |
ctct |
204 |
Q |
| |
|
|||| |
|
|
| T |
33751366 |
ctct |
33751369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University