View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_47 (Length: 341)
Name: NF16569_high_47
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 13 - 324
Target Start/End: Complemental strand, 28530450 - 28530139
Alignment:
| Q |
13 |
agcaaaggaatggtagaaaatctcctcacagacttaaacctcaatgcatcaatcatagccttccattggtgccctccatctcctcctcctggtgatgatg |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530450 |
agcaaaggaatgctagaaaatctcctcacagacttaaacctcaatgcatcaatcatagccttccattggtgccctccatctcctcctcctggtgatgatg |
28530351 |
T |
|
| Q |
113 |
gtttacctccattgctgtagttgctgctccccgtgctgtcggaatctgaaataggtacctcaaatacacctcttggtgatgctgttggtgaatcattgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530350 |
gtttacctccattgctgtagttgctgctccccgtgctgtcggaatccgaaataggtacctcaaatacacctcttggtgatgctgttggtgaatcattgtt |
28530251 |
T |
|
| Q |
213 |
gttttcatttgcaaaaccaaactctttctttggattattgttattacccgttatcatatcgaccattctccatctcttttctttcttttcttgatccctt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28530250 |
gttttcatttgcaaaaccaaactctttctttggattattgttattacccgttatcatatcgaccattctccatctcttttctttcttttcttgatccctt |
28530151 |
T |
|
| Q |
313 |
ttgttccttaat |
324 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28530150 |
ttgttccttaat |
28530139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University