View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_64 (Length: 306)
Name: NF16569_high_64
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_64 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 18570219 - 18569914
Alignment:
| Q |
1 |
gatgatccttggaagatcaagaaggtgctccaagaggatgatattgttgataagctattgttggacaaagatttggtagaggaattggtgttgcctgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18570219 |
gatgatccttggaagatcaagaaggtgctccaagaggatgatattgttgataagctattgttggacaaagatttggtagaggaattggtgttgcctgtgt |
18570120 |
T |
|
| Q |
101 |
tgagtgctggtgctgatcttgaaaaaggagctttggttaggatttttgattatgacaccgaatccatgcatgttctggttcataagagatgtgtttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18570119 |
tgagtgctggtgctgatcttgaaagaggagctttggttaggatttttgattatgacactgaatccatgcatgttctggttcataagagatgtgtttcttc |
18570020 |
T |
|
| Q |
201 |
aggaaactatggtttctttgacaattggttctatgattttgttagaagaaggggattaaagaaaggagatgaaattggcttccattgggatccatatatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18570019 |
aggaaactatggtttctttgacaattggttctatgattttgttagaagaaggggattaaagaaaggagatgaaattggcttccattgggatccatatatg |
18569920 |
T |
|
| Q |
301 |
aaacac |
306 |
Q |
| |
|
|||||| |
|
|
| T |
18569919 |
aaacac |
18569914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University