View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_69 (Length: 274)
Name: NF16569_high_69
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 30401458 - 30401703
Alignment:
| Q |
18 |
tagaggatgtctacccaattttggtatatgaatatttggacaagggaagttttgacaaatgtttgtttaaaagtatgttattagttttccttcttctatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30401458 |
tagaggatgtctacccaattttggtatatgaatatttggacaagggaagttttgacaaatgtttgtttaaaagtatgttattagttttccttcttctatt |
30401557 |
T |
|
| Q |
118 |
aattattttcaagnnnnnnnatttgtcgacttcattttctagttagtagaaaatctcatctcaatctacctattttatatgatgcaggggggtctgattt |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30401558 |
aattattttcaagtttttttatttgtcgacttcattttctagttagtagaaaatctcatctcaatctacctattttatatgatgcaggggggtctgattt |
30401657 |
T |
|
| Q |
218 |
ccagccactcccatggaaaatgcgaatgaagatagctcttgatgct |
263 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
30401658 |
ccagccactctcatggaaaatgcgaatcaagatagctcttgatgct |
30401703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 219 - 261
Target Start/End: Original strand, 30405020 - 30405062
Alignment:
| Q |
219 |
cagccactcccatggaaaatgcgaatgaagatagctcttgatg |
261 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30405020 |
cagccactcacatggaaaatccgaatgaagatagctcttgatg |
30405062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 30421851 - 30421933
Alignment:
| Q |
18 |
tagaggatgtctacccaattttggtatatgaatatttggacaagggaagttttgacaaatgtttgtttaaaagtatgttatta |
100 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | || |||||||||||| || || |||||||| ||||||||||||| |
|
|
| T |
30421851 |
tagaggatgactaccggattttggtatatgaatttgtgaccaagggaagtttggataatcatttgtttagaagtatgttatta |
30421933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 219 - 260
Target Start/End: Original strand, 30422062 - 30422103
Alignment:
| Q |
219 |
cagccactcccatggaaaatgcgaatgaagatagctcttgat |
260 |
Q |
| |
|
||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
30422062 |
cagccactctcttggaaaatccgaatgaagatagctcttgat |
30422103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 216 - 263
Target Start/End: Original strand, 31445746 - 31445793
Alignment:
| Q |
216 |
ttccagccactcccatggaaaatgcgaatgaagatagctcttgatgct |
263 |
Q |
| |
|
|||||||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
31445746 |
ttccagccactctcttggaaaatccgaatgaagatagctcttgatgct |
31445793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University