View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_71 (Length: 265)
Name: NF16569_high_71
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_71 |
 |  |
|
| [»] scaffold1194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1194 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold1194
Description:
Target: scaffold1194; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 648 - 422
Alignment:
| Q |
14 |
ataattctggtatggtgtaatgtgataaacttattaatgcacaataatacaatccttaataatgcaatattttcaggtaagggatttcaacgttgcaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
648 |
ataattctggtatggtgtaatgtgataaacttattaatgcacaataatacaatccttaataatgcaatattttcaggtaagggatttcaacgttgcaaaa |
549 |
T |
 |
| Q |
114 |
gaagaagctgatataagttattatgctggttatgttggtaagattttcttcnnnnnnnnnnnnagtattttctagaagaatattatcgttgatttatgtt |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||| | |||||||||||||| ||||| |||||| |
|
|
| T |
548 |
gaagaagctgatataagttattacgctggttatgttggtaagaatttctt-------ttttttagtatttccaagaagaatattatcattgatatatgtt |
456 |
T |
 |
| Q |
214 |
tttcattgaagatgattgaaaatgttgtaggatct |
248 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||| |
|
|
| T |
455 |
cttcattgaag-tgactgaaaatgctgtaggatct |
422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 16529826 - 16529597
Alignment:
| Q |
14 |
ataattctggtatggtgtaatgtgataaacttattaatgcacaataatacaatccttaataatgcaa----tattttcaggtaagggatttcaacgttgc |
109 |
Q |
| |
|
||||| |||||||| | || ||||||||| | ||||||||||| ||||| | |||| ||||||| || ||| ||||||||||||||||||||||||| |
|
|
| T |
16529826 |
ataatactggtatgatctactgtgataaaatgattaatgcaca-taatatactcctcaataatgaaactcttatgttcaggtaagggatttcaacgttgc |
16529728 |
T |
 |
| Q |
110 |
aaaagaagaagctgatataagttattatgctggttatgttggtaagattttcttcnnnnnnnnnnnnagtattttctagaagaatattatcgttgattta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||| ||||| || |
|
|
| T |
16529727 |
aaaagaagaagctgatataagttattatgctggttatgttggtaagattttctt-------ttttttagtatttccaagaagaatattatcattgatata |
16529635 |
T |
 |
| Q |
210 |
tgtttttcattgaagatgattgaaaatgttgtaggatct |
248 |
Q |
| |
|
|||| |||||||||| ||| |||||||| |||||||||| |
|
|
| T |
16529634 |
tgttcttcattgaag-tgactgaaaatgctgtaggatct |
16529597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 55 - 158
Target Start/End: Complemental strand, 16589792 - 16589685
Alignment:
| Q |
55 |
caataatacaatccttaataatgcaa----tattttcaggtaagggatttcaacgttgcaaaagaagaagctgatataagttattatgctggttatgttg |
150 |
Q |
| |
|
|||||||||||| || |||||||||| |||||| |||||||||| ||||| ||||||||||||||||||||||| ||||| |||||||||||| ||| |
|
|
| T |
16589792 |
caataatacaatgctcaataatgcaacatttatttttaggtaagggacttcaatgttgcaaaagaagaagctgatattagttactatgctggttatattg |
16589693 |
T |
 |
| Q |
151 |
gtaagatt |
158 |
Q |
| |
|
|||||||| |
|
|
| T |
16589692 |
gtaagatt |
16589685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University