View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_78 (Length: 256)
Name: NF16569_high_78
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 44 - 241
Target Start/End: Complemental strand, 10368343 - 10368146
Alignment:
| Q |
44 |
taaaatttcaatgtgaatttattctaacagatgatgtaaaagactccaacaaaataaaactatcttatcattgcttactgatcatgtgcactgatttcaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10368343 |
taaaatttcaatgtgaatttattctaacagatgatgtaaaagactccaacaaaataaaactatcttatcattgcttactgatcatgtgcattgatttcaa |
10368244 |
T |
|
| Q |
144 |
tgctattgggtcgggtgcaagtgaatcgaattcgaaactgtatcgaaatccaacggctttcagtccatgtatgatccacaagatgaagctcaaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368243 |
tgctattgggtcgggtgcaagtgaatcgaattcgaaactgtatcgaaatccaacggctttcagtccatgtatgatccacaagatgaagctcaaataat |
10368146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University