View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_high_9 (Length: 557)

Name: NF16569_high_9
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_high_9
NF16569_high_9
[»] chr4 (29 HSPs)
chr4 (1-516)||(21055242-21055775)
chr4 (439-537)||(40780862-40780961)
chr4 (470-537)||(4738660-4738728)
chr4 (377-537)||(29895735-29895897)
chr4 (470-537)||(14859333-14859401)
chr4 (376-537)||(13073485-13073648)
chr4 (439-537)||(24166461-24166560)
chr4 (439-537)||(55921045-55921144)
chr4 (377-537)||(43458561-43458723)
chr4 (465-537)||(7246647-7246720)
chr4 (465-533)||(8889059-8889128)
chr4 (467-520)||(31635766-31635819)
chr4 (469-537)||(36145216-36145285)
chr4 (439-534)||(8064802-8064898)
chr4 (382-529)||(20421727-20421875)
chr4 (464-534)||(14597904-14597975)
chr4 (377-510)||(1446774-1446908)
chr4 (464-537)||(15839936-15840010)
chr4 (455-488)||(6862251-6862284)
chr4 (465-537)||(16450337-16450410)
chr4 (465-537)||(17080080-17080153)
chr4 (465-537)||(38166064-38166137)
chr4 (470-537)||(6032644-6032712)
chr4 (377-516)||(6779159-6779299)
chr4 (470-537)||(14858752-14858820)
chr4 (468-520)||(23788437-23788489)
chr4 (470-510)||(24850656-24850696)
chr4 (465-505)||(31588723-31588763)
chr4 (454-537)||(47682383-47682467)
[»] chr3 (17 HSPs)
chr3 (377-537)||(51060283-51060445)
chr3 (377-537)||(35315899-35316061)
chr3 (376-537)||(29762157-29762320)
chr3 (471-537)||(47219182-47219249)
chr3 (439-537)||(53649733-53649832)
chr3 (377-494)||(11687155-11687273)
chr3 (377-537)||(29127862-29128024)
chr3 (376-537)||(3136696-3136858)
chr3 (378-534)||(35923628-35923786)
chr3 (465-537)||(54237480-54237553)
chr3 (470-537)||(45450449-45450517)
chr3 (470-537)||(49021205-49021273)
chr3 (375-520)||(33251603-33251749)
chr3 (465-537)||(45877486-45877559)
chr3 (465-537)||(54261258-54261331)
chr3 (470-537)||(23511604-23511672)
chr3 (463-534)||(40660332-40660404)
[»] chr1 (19 HSPs)
chr1 (378-537)||(41663858-41664019)
chr1 (439-537)||(26325819-26325918)
chr1 (376-537)||(8763934-8764097)
chr1 (439-537)||(45726435-45726534)
chr1 (407-520)||(10336490-10336604)
chr1 (465-537)||(10422821-10422894)
chr1 (470-537)||(17389809-17389877)
chr1 (439-537)||(17642006-17642105)
chr1 (465-520)||(33498859-33498914)
chr1 (464-510)||(35908790-35908836)
chr1 (465-537)||(4581684-4581757)
chr1 (465-537)||(16263578-16263651)
chr1 (465-506)||(28324614-28324655)
chr1 (482-534)||(31576552-31576605)
chr1 (471-520)||(38791630-38791679)
chr1 (465-537)||(49078147-49078220)
chr1 (454-537)||(26660160-26660243)
chr1 (376-447)||(46929830-46929902)
chr1 (490-537)||(51437515-51437563)
[»] chr7 (15 HSPs)
chr7 (407-537)||(43861973-43862105)
chr7 (377-537)||(48804629-48804791)
chr7 (473-537)||(48551900-48551965)
chr7 (463-537)||(3353457-3353532)
chr7 (465-534)||(1797495-1797565)
chr7 (465-537)||(17748383-17748456)
chr7 (465-537)||(38578868-38578941)
chr7 (439-504)||(43925521-43925586)
chr7 (465-538)||(18785704-18785778)
chr7 (377-537)||(27875089-27875250)
chr7 (452-537)||(41945495-41945581)
chr7 (465-534)||(45960007-45960077)
chr7 (465-537)||(27028314-27028387)
chr7 (407-537)||(10047877-10048009)
chr7 (470-537)||(44961639-44961707)
[»] chr6 (16 HSPs)
chr6 (439-537)||(5029827-5029926)
chr6 (413-537)||(8932644-8932770)
chr6 (413-537)||(8944110-8944236)
chr6 (377-537)||(8938658-8938820)
chr6 (455-520)||(374993-375058)
chr6 (407-537)||(6606098-6606230)
chr6 (439-537)||(5253224-5253323)
chr6 (470-520)||(2271322-2271372)
chr6 (465-537)||(9633626-9633699)
chr6 (465-537)||(21898684-21898757)
chr6 (465-537)||(29444766-29444839)
chr6 (407-537)||(30788854-30788984)
chr6 (407-537)||(13036005-13036137)
chr6 (470-537)||(30410486-30410554)
chr6 (470-533)||(32157172-32157236)
chr6 (407-529)||(34954628-34954752)
[»] chr5 (21 HSPs)
chr5 (407-521)||(14974342-14974457)
chr5 (423-533)||(41800967-41801079)
chr5 (470-537)||(42086365-42086433)
chr5 (376-537)||(20525781-20525944)
chr5 (377-502)||(18136317-18136443)
chr5 (452-537)||(21375371-21375457)
chr5 (476-537)||(27648426-27648488)
chr5 (464-537)||(41163461-41163535)
chr5 (465-537)||(9805037-9805110)
chr5 (465-537)||(14728116-14728189)
chr5 (465-537)||(23383690-23383763)
chr5 (465-537)||(42291506-42291579)
chr5 (439-537)||(1538438-1538537)
chr5 (454-505)||(22295238-22295289)
chr5 (407-537)||(23247353-23247484)
chr5 (407-516)||(24498957-24499066)
chr5 (465-537)||(5731921-5731994)
chr5 (465-537)||(43399161-43399234)
chr5 (465-537)||(5079364-5079436)
chr5 (470-537)||(14588618-14588686)
chr5 (470-537)||(20255407-20255475)
[»] chr8 (11 HSPs)
chr8 (465-537)||(4479297-4479370)
chr8 (473-537)||(43027349-43027414)
chr8 (465-532)||(24938568-24938636)
chr8 (464-537)||(993223-993297)
chr8 (377-537)||(45521116-45521277)
chr8 (441-516)||(22958782-22958857)
chr8 (470-505)||(28333078-28333113)
chr8 (465-520)||(35496274-35496329)
chr8 (465-537)||(2467119-2467192)
chr8 (470-534)||(18374051-18374116)
chr8 (470-537)||(36662445-36662513)
[»] scaffold0029 (1 HSPs)
scaffold0029 (439-537)||(41053-41152)
[»] chr2 (18 HSPs)
chr2 (463-537)||(2784962-2785037)
chr2 (439-533)||(37560179-37560274)
chr2 (377-537)||(14169610-14169772)
chr2 (407-537)||(25540405-25540537)
chr2 (377-537)||(12864167-12864329)
chr2 (377-537)||(19976808-19976970)
chr2 (432-537)||(34722679-34722785)
chr2 (465-537)||(3643888-3643961)
chr2 (473-537)||(20116613-20116678)
chr2 (441-533)||(39201513-39201606)
chr2 (432-516)||(24179568-24179651)
chr2 (465-505)||(30721889-30721929)
chr2 (377-537)||(8410074-8410236)
chr2 (439-505)||(10026650-10026716)
chr2 (377-537)||(38005345-38005507)
chr2 (377-505)||(18649060-18649189)
chr2 (465-537)||(22593166-22593238)
chr2 (465-533)||(28525460-28525529)
[»] scaffold0011 (2 HSPs)
scaffold0011 (420-533)||(186507-186621)
scaffold0011 (429-537)||(224315-224425)
[»] scaffold0016 (1 HSPs)
scaffold0016 (465-537)||(8702-8775)
[»] scaffold0009 (1 HSPs)
scaffold0009 (465-537)||(42833-42906)
[»] scaffold0001 (1 HSPs)
scaffold0001 (465-537)||(65153-65226)
[»] scaffold0291 (1 HSPs)
scaffold0291 (439-537)||(6864-6963)
[»] scaffold0005 (1 HSPs)
scaffold0005 (464-534)||(219403-219474)
[»] scaffold0004 (1 HSPs)
scaffold0004 (439-537)||(7836-7935)
[»] scaffold0002 (1 HSPs)
scaffold0002 (465-537)||(319457-319530)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 29)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 516
Target Start/End: Complemental strand, 21055775 - 21055242
Alignment:
1 gccaaagaatccatttgtaatatttatgaaaatggnnnnnnncttgttg---aggtctaataccatgtttatgcatgagtttcattttaacatagtatcc 97  Q
    |||||||||||||||||||||||||||||||||||       |||||||   ||||||||||||||||||||||||||||||||||||||||||||||||    
21055775 gccaaagaatccatttgtaatatttatgaaaatggtttttttcttgttgttgaggtctaataccatgtttatgcatgagtttcattttaacatagtatcc 21055676  T
98 nnnnnnnnnnnnnnnnnnnnncttgtgattctgatccatttcattgattgaacnnnnnnnctataagaaggtgaagggaaagagattgaaggtgaaggat 197  Q
                         |||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||    
21055675 tttgttttttgagggttttttcttgtgattctgatccatttcattgattgaaaaaaaaaactataagaaggtgaagggaaagagattgaaggtgaaggat 21055576  T
198 gttgagagggtgagaaggtgttttctttgtctggtatggcttagaagtagaagctaagaaaca---------aggaaaggtgtg---agttttg--ttag 283  Q
    ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||         |||||| |   |   || | ||  ||||    
21055575 gttgagaggttgagaaggtgttttcttggtctggtatggcttagaagtagaagctaagaaacagtgacaggaaggaaatgaagggaaaggtgtgggttag 21055476  T
284 aacttcgttattgcacagaggataaacaaatagggtactatttttgtattttattttggacaaaatggggtttggttaaattaatgtttcgaaaaccaag 383  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||    
21055475 aacttcgttattgcatagaggataaacaaatagggtactatttttgtattttattttggacaaaatggggtttggttaaattaatgttttgaaaactaag 21055376  T
384 ttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtc 482  Q
    ||||||| ||| | | | ||| ||| ||||| ||||||||||||||||||||||||| ||||||| ||| || |||||||||||| || |||||||||||    
21055375 ttgtttgagctacaggggcaggaagttcatttcaaagatgtatctggagaatatcggattcgattttcagagagaataatatttgatccgtgcgcatgtc 21055276  T
483 tctacgtatgagctggattagtcatccatctttg 516  Q
    |||| | |||| |||||||| || | ||||||||    
21055275 tctatgcatgaactggattaatcgtacatctttg 21055242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 439 - 537
Target Start/End: Complemental strand, 40780961 - 40780862
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||||||| ||||| ||   |||||||||||||||| ||||||| |||||| ||||||||| |||| ||||| | |||||||||||||||||||    
40780961 ggttcgattctcaaggggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaa 40780862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 4738660 - 4738728
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||||||||||| |||||||| ||||||| |||| ||||| | |||||||||||||||||||    
4738660 cagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaa 4738728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 29895735 - 29895897
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||   ||||| |||||| || ||||| || ||||| ||| |||||||| ||  ||||| || | |||| ||||||    
29895735 aaccaagttgcttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgc 29895834  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||| ||||||| |||||| ||||||||| |||| | ||| ||| |||||||||||||||||    
29895835 gcatgcctctacgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaa 29895897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 14859333 - 14859401
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||||||||||| | ||||  ||||||||||||| |||||||| ||||||||| ||||||||    
14859333 cagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaa 14859401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 376 - 537
Target Start/End: Original strand, 13073485 - 13073648
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcg-gttcgattctcaaagggaataatatttggtcagtg 474  Q
    |||||||||||||||||||   ||| || | ||||| |||||| || ||| |||||||||| || ||||||||| ||  ||||| ||| ||||| |||||    
13073485 aaaccaagttgtttgggctctagtggcaatgagctccttccaaggacgtacctggagaataccgagttcgattcccatggggaacaatgtttggccagtg 13073584  T
475 cgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||  ||||||| |||| |  |||||||| |  | ||||| | |||||||||||||||||||    
13073585 cgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaa 13073648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 24166461 - 24166560
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||||| ||| || || ||  ||||| ||||||||||| ||||||| | ||||  ||||||||| ||| ||||||||| |||||||||||||||||    
24166461 ggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaa 24166560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 55921045 - 55921144
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||||||||||||||| |||||||||||||| |||||| ||   || ||||| | |||||||||||||||||||    
55921045 ggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaa 55921144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 43458561 - 43458723
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||  ||||||||||||| || |||| ||| |||||  || |||||||| ||   |||| ||   |||| ||||||    
43458561 aaccaagttgcttgggctccagtggcaagaagctcattccaaggacgtatttggggaatactggattcgattcccaggaggaagaacgcttggccagtgc 43458660  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| | |||| ||||||||| |||| |||||||| ||||||||||| ||||||    
43458661 gcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaa 43458723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 7246720 - 7246647
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| |||||||||  ||| ||||| | |||||||||||||||||||    
7246720 ttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 7246647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 533
Target Start/End: Original strand, 8889059 - 8889128
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtg 533  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||| | |||||||||||||||    
8889059 ttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 467 - 520
Target Start/End: Complemental strand, 31635819 - 31635766
Alignment:
467 ggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    |||||||||||||||||||||| ||||| ||||||| ||  |||||||||||||    
31635819 ggtcagtgcgcatgtctctacgcatgagttggattaatcgcccatctttgatgg 31635766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 469 - 537
Target Start/End: Complemental strand, 36145285 - 36145216
Alignment:
469 tcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    |||||||||||| ||||||  |||||| ||||||||| |||| ||||||||  |||||||||||||||||    
36145285 tcagtgcgcatgcctctacacatgagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaa 36145216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 439 - 534
Target Start/End: Complemental strand, 8064898 - 8064802
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgc 534  Q
    |||||||||| ||| |||||||| | |||  ||||||||||| ||||||| |||||| ||||||||| |||| | || || ||||| ||||||||||    
8064898 ggttcgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattaataggtcgaaaaccggtgc 8064802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 382 - 529
Target Start/End: Original strand, 20421727 - 20421875
Alignment:
382 agttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcggttcgattctcaaagggaataatatttggtcagtgcgcatgt 481  Q
    ||||| ||||||||| ||| ||   ||||| || |||||| |||||||| |||||  |||||||||  ||  ||||| || | |||| |||||||||||     
20421727 agttgcttgggcttcagtggcaaggagctcctttcaaagacgtatctggggaatactggttcgatttccagggggaacaacacttggccagtgcgcatgc 20421826  T
482 ctctacgtatgagctggattagtcatccatctttgat-ggtcggaaacc 529  Q
    ||||||| ||||||  ||||| || |||||| ||||| |||||||||||    
20421827 ctctacgcatgagccagattaatcgtccatcattgatgggtcggaaacc 20421875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 464 - 534
Target Start/End: Complemental strand, 14597975 - 14597904
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgc 534  Q
    ||||| ||||||||||| ||||||| | || ||||||||||| |||| ||||||||| ||| ||||||||||    
14597975 tttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgc 14597904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 510
Target Start/End: Original strand, 1446774 - 1446908
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||   ||||| |||||| || ||||| || ||||| ||| |||||||| ||  ||||| || | |||| ||||||    
1446774 aaccaagttgcttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgc 1446873  T
476 gcatgtctctacgtatgagctggattagtcatcca 510  Q
    ||||| ||||||| |||||| ||||||||| ||||    
1446874 gcatgcctctacgcatgagccggattagtcgtcca 1446908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 464 - 537
Target Start/End: Complemental strand, 15840010 - 15839936
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||||||| ||||||| |||||| |||||||||  || |||||||| ||| ||||||| |||||||    
15840010 tttggccagtgcgcatgcctctacgcatgagccggattagtcgcccttctttgataggttggaaaccagtgcgaa 15839936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 455 - 488
Target Start/End: Original strand, 6862251 - 6862284
Alignment:
455 ggaataatatttggtcagtgcgcatgtctctacg 488  Q
    ||||||||| ||||||||||||||||||||||||    
6862251 ggaataatacttggtcagtgcgcatgtctctacg 6862284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 16450337 - 16450410
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| |||||| |||| ||||||| ||||||  |||||||| |||| ||||| | |||||||||||||||||||    
16450337 ttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaa 16450410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 17080080 - 17080153
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| |||||||||   || ||||||||| ||| |||||||||||||    
17080080 ttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaa 17080153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 38166064 - 38166137
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| | |||| |||||||||  ||| ||||| | |||||||||||||||||||    
38166064 ttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 38166137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Complemental strand, 6032712 - 6032644
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||| |||| ||||||| |||||| ||||||||| || | ||||| ||| |||||||||||||||||    
6032712 cagtgctcatgcctctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaa 6032644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 377 - 516
Target Start/End: Original strand, 6779159 - 6779299
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   ||||  |||||| || ||| |||||||||| ||| |||||||| ||  ||||| || |  ||| ||||||    
6779159 aaccaagttgtttgggctccagtggcaaggagcttcttccaaggacgtacctggagaataccgggttcgattcccagggggaacaacacctggccagtgc 6779258  T
476 gcatgtctctacgtatgagctggattagtcatccatctttg 516  Q
    ||||| ||||| | |||||| ||||||||| |||| |||||    
6779259 gcatgcctctatgcatgagccggattagtcgtccacctttg 6779299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 14858752 - 14858820
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||||||||||||| |||   ||||| || |||| ||||||| |||| ||||||||||||||    
14858752 cagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaa 14858820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 468 - 520
Target Start/End: Original strand, 23788437 - 23788489
Alignment:
468 gtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    ||||||||||||| ||||||| | |||||||||||||| | ||| ||||||||    
23788437 gtcagtgcgcatgcctctacgcacgagctggattagtcgttcatttttgatgg 23788489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 510
Target Start/End: Complemental strand, 24850696 - 24850656
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatcca 510  Q
    ||||||||||| ||||||| ||||||||||||| |||||||    
24850696 cagtgcgcatgcctctacgcatgagctggattattcatcca 24850656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 465 - 505
Target Start/End: Original strand, 31588723 - 31588763
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||| ||||||||||||||||||| |||||| |||||||||    
31588723 ttggccagtgcgcatgtctctacgcatgagccggattagtc 31588763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 454 - 537
Target Start/End: Complemental strand, 47682467 - 47682383
Alignment:
454 gggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||  ||||| |||||| |||||||||||| | |||| || ||||||  ||| ||||| | |||||||||||||||||||    
47682467 gggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaa 47682383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 51; Significance: 6e-20; HSPs: 17)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 377 - 537
Target Start/End: Complemental strand, 51060445 - 51060283
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    ||||||||||||||| || | ||| ||   ||||| |||||| ||| |||| || ||||||||| |||||||||||  ||||| || | |||||||||||    
51060445 aaccaagttgtttggactccagtggcaaatagctccttccaaggatctatccggggaatatcgggttcgattctcagggggaacaacacttggtcagtgc 51060346  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| |||| ||||||||||| |||| | ||| | |||||||||||||||||||    
51060345 gcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 51060283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 35315899 - 35316061
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   ||||| |||||| || ||| | |||||||||||| |||||||| ||  ||||| || | |||| ||||||    
35315899 aaccaagttgtttgggctccagtggcaaagagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgc 35315998  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| ||||||||||||||||  |||  |||| | |||||||||||| ||||||    
35315999 gcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaa 35316061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 376 - 537
Target Start/End: Complemental strand, 29762320 - 29762157
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcggttc-gattctcaaagggaataatatttggtcagtg 474  Q
    ||||||||||| ||||||| | ||| ||   ||||| |||||| |||||||  || ||||||||| || ||||||||  || || || | |||| |||||    
29762320 aaaccaagttgcttgggctccagtggcaaggagctccttccaaggatgtattcggggaatatcgggtccgattctcaggggcaacaacacttggccagtg 29762221  T
475 cgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||| ||||| | |||||||||||||||| |||| | ||| | |||||||||||||||||||    
29762220 cgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 29762157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 471 - 537
Target Start/End: Original strand, 47219182 - 47219249
Alignment:
471 agtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||||| ||||||| |||||| ||||||||| |||| ||||||||| |||||||||||||||||    
47219182 agtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtgcgaa 47219249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 53649733 - 53649832
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||||||||  | ||| || | |||| |||||||| |||||||||| |||||| ||||||||| | || ||||||||| |||||||||||||||||    
53649733 ggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaa 53649832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 377 - 494
Target Start/End: Complemental strand, 11687273 - 11687155
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||  |||||| |||||| || ||| |||||||||| ||| || ||||||||  ||||| |||  |||| ||||||    
11687273 aaccaagttgtttgggctccagtggcaagaagctccttccaaggacgtacctggagaataccgggtttgattctcagggggaacaatgcttggccagtgc 11687174  T
476 gcatgtctctacgtatgag 494  Q
    ||||| |||||||||||||    
11687173 gcatgcctctacgtatgag 11687155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 29127862 - 29128024
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   || || |||||| || |||||||| ||||||||| |||||||  ||  | ||| || | |||||||||||    
29127862 aaccaagttgtttgggctccagtggcaaggagatccttccaaggacgtatctggggaatatcgggttcgatttccagggagaacaacacttggtcagtgc 29127961  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| |||||| |||||||||  ||| ||||| | |||||||||||| ||||||    
29127962 gcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaa 29128024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 376 - 537
Target Start/End: Complemental strand, 3136858 - 3136696
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtg 474  Q
    |||| |||||||||||||| ||||| ||  |||||| || ||| || ||| | || ||||| ||| ||||||| |||  ||||| || | |||| |||||    
3136858 aaacaaagttgtttgggctcccgtggcaagaagctcctttcaaggacgtacccggggaataccggattcgattttcag-gggaacaacacttgggcagtg 3136760  T
475 cgcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
    |||||| ||||||| |||||  ||||||||| |||| |||| | ||||||||||||||||||||    
3136759 cgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaa 3136696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 534
Target Start/End: Complemental strand, 35923786 - 35923628
Alignment:
378 accaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatc-ggttcgattctcaaagggaataatatttggtcagtgcg 476  Q
    |||||||||||||||||   ||| || | |||||||||||| || ||| |||||||||| | ||||||||||  |  ||||| ||  ||||| |||||||    
35923786 accaagttgtttgggctctagtggcaatgagctcattccaaggacgtacctggagaataccaggttcgattcatagggggaacaacgtttggccagtgcg 35923687  T
477 catgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgc 534  Q
    |||| ||||| | | |||  | ||||||| |||||||||||||| ||| ||||||||||    
35923686 catgcctctaagcacgagtcgaattagtcgtccatctttgatggatcgaaaaccggtgc 35923628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 54237480 - 54237553
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatc-tttgatggtcggaaaccggtgcgaa 537  Q
    |||||||||||||||||||||||| |||||| |||| |||| |||| | || |  |||||||||||||||||||    
54237480 ttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaa 54237553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 470 - 537
Target Start/End: Complemental strand, 45450517 - 45450449
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| || |||| |||||||| |||| |||||||| || |||||||||||||||    
45450517 cagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaa 45450449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 470 - 537
Target Start/End: Complemental strand, 49021273 - 49021205
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| |||||| ||||||||| |||| | ||| | |||||||||||||||||||    
49021273 cagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 49021205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 375 - 520
Target Start/End: Original strand, 33251603 - 33251749
Alignment:
375 aaaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatc-ggttcgattctcaaagggaataatatttggtcagt 473  Q
    |||||||||||||||||||| | ||| || | ||||| |||||| || ||||  || ||||| | |||||||||| |   ||||| ||  ||||| ||||    
33251603 aaaaccaagttgtttgggctccggtggcaatgagctccttccaaggacgtattaggggaataccgggttcgattcccggtgggaacaacgtttggccagt 33251702  T
474 gcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    | ||||| ||||||| |||||| ||||||||| ||||  ||||||||    
33251703 gtgcatgcctctacgcatgagccggattagtcgtccacatttgatgg 33251749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 45877486 - 45877559
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| |||||| |||| ||||||| |||||| ||||||||| | || | ||||||| |||||||||||||||||    
45877486 ttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaa 45877559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 54261258 - 54261331
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| | || |||| |  |||||||||||||||||||    
54261258 ttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaa 54261331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 23511604 - 23511672
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| |||||  |||||| || |||| ||||||| ||||| |||||||||||||    
23511604 cagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcgaa 23511672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 463 - 534
Target Start/End: Complemental strand, 40660404 - 40660332
Alignment:
463 atttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgc 534  Q
    |||||||||||||||||| ||||||| |||| | |||||| |||| || ||||| | ||||| ||||||||||    
40660404 atttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcgaaaaccggtgc 40660332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 6e-17; HSPs: 19)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 378 - 537
Target Start/End: Complemental strand, 41664019 - 41663858
Alignment:
378 accaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcg 476  Q
    ||||||||||||||||| | ||| ||   ||||| ||| || || ||||| || ||||| ||| |||||||| ||  ||||| || | ||||||||||||    
41664019 accaagttgtttgggctccagtggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcg 41663920  T
477 catgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||| |||||||||||||||| |||| | ||| | |||||||||||||||||||    
41663919 catgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 41663858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 26325819 - 26325918
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||||||||||||||| ||||||| |||||| ||||||||| |||| | ||| | |||||||||||||||||||    
26325819 ggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 26325918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 376 - 537
Target Start/End: Original strand, 8763934 - 8764097
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtg 474  Q
    ||||||||||| ||||||| ||||| ||   ||||| |||||| || ||| | || ||||||||| |||| ||| ||  ||||| || | |||| |||||    
8763934 aaaccaagttgcttgggctcccgtggcaaggagctccttccaaggacgtacccggggaatatcgggttcgtttcccagggggaacaacacttggccagtg 8764033  T
475 cgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||| ||||||| | |||| ||||||||| |||| | ||| | |||||||||||||||||||    
8764034 cgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaa 8764097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 439 - 537
Target Start/End: Complemental strand, 45726534 - 45726435
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||||||||   ||||||| |||||| ||||||| ||||||||||| |||||| ||||||||| | || ||||| ||| ||||| || ||||||||    
45726534 ggttcgattctcaggaggaataacatttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacctttggtggatcggagactggtgcgaa 45726435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 407 - 520
Target Start/End: Original strand, 10336490 - 10336604
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| ||||||||| ||||| |||||||||||| ||||||| |||  ||||| ||   |||  ||||||||||| ||||||| |||||| |||||| ||    
10336490 agctccttccaaagacgtatccggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatc 10336589  T
506 atccatctttgatgg 520  Q
     |||| |||||||||    
10336590 gtccacctttgatgg 10336604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 10422821 - 10422894
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||| |  ||||||||||||||||||    
10422821 ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaa 10422894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 17389809 - 17389877
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||| ||| |||||||||||||||| |||||   |||| |||||||||||||||||||    
17389809 cagtgcgcatgcctccacgcatgagctggattagtcgtccattgctgatgggtcggaaaccggtgcgaa 17389877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 439 - 537
Target Start/End: Complemental strand, 17642105 - 17642006
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||| ||||||||||| ||||||| | |||| ||||||||| |||| ||||| | |||||||||| ||||||||    
17642105 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaa 17642006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 465 - 520
Target Start/End: Complemental strand, 33498914 - 33498859
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| |||| |||||||||    
33498914 ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgg 33498859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 464 - 510
Target Start/End: Original strand, 35908790 - 35908836
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatcca 510  Q
    ||||||||||||||||| ||||||| |||||| ||||||||| ||||    
35908790 tttggtcagtgcgcatgcctctacgcatgagccggattagtcgtcca 35908836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 4581757 - 4581684
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| | |||| ||| ||||| |||| ||||| | |||||||||||||||||||    
4581757 ttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaa 4581684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 16263578 - 16263651
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| || ||| ||| ||||| ||||  |||||||| |||||||||||||||||    
16263578 ttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaaaccggtgcgaa 16263651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 506
Target Start/End: Complemental strand, 28324655 - 28324614
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtca 506  Q
    |||||||||||||||| ||||||| |||||| ||||||||||    
28324655 ttggtcagtgcgcatgcctctacgcatgagccggattagtca 28324614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 482 - 534
Target Start/End: Complemental strand, 31576605 - 31576552
Alignment:
482 ctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgc 534  Q
    ||||||| |||||| || |||||| ||||||||||||| |||||||||||||||    
31576605 ctctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgc 31576552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 471 - 520
Target Start/End: Complemental strand, 38791679 - 38791630
Alignment:
471 agtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    |||||||||| ||||||| |||||| | ||||||| ||||||||||||||    
38791679 agtgcgcatgcctctacgcatgagccgaattagtcgtccatctttgatgg 38791630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 49078147 - 49078220
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| | || | ||| | |||||||||||||||||||    
49078147 ttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaa 49078220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 454 - 537
Target Start/End: Original strand, 26660160 - 26660243
Alignment:
454 gggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||| || ||||| ||||| |||||| ||||||| |||||| |||||||||  ||| ||||| ||| |||||||||||||||||    
26660160 gggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggtgggtcggaaaccggtgcgaa 26660243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 376 - 447
Target Start/End: Complemental strand, 46929902 - 46929830
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcg-gttcgatt 447  Q
    ||||||||||| |||||||   ||| ||  |||||| ||||||||| ||||||||||||||||| ||||||||    
46929902 aaaccaagttgcttgggctctagtggcaagaagctccttccaaagacgtatctggagaatatcgagttcgatt 46929830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 490 - 537
Target Start/End: Original strand, 51437515 - 51437563
Alignment:
490 atgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||| |||||||||||||| ||||| | |||||||||||||||||||    
51437515 atgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaa 51437563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 43862105 - 43861973
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| ||||||||| |||||||| ||||| ||| |||||||| ||  ||||| ||  ||||| ||||||||||| ||||||| |||||| |||||||||    
43862105 agctctttccaaagacgtatctggggaataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtc 43862006  T
506 atccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    || || ||||| ||| ||| |||||||||||||    
43862005 attcacctttggtggatcgaaaaccggtgcgaa 43861973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 48804629 - 48804791
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||   ||||| |||||| || ||||| || ||||| ||| |||||||| ||| ||||| || | |||| ||||||    
48804629 aaccaagttgcttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaaggggaacaacacttggccagtgc 48804728  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| |||||| ||||||||| |||| | ||| | |||||||||||||||||||    
48804729 gcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 48804791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 473 - 537
Target Start/End: Original strand, 48551900 - 48551965
Alignment:
473 tgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||| |||||||||||||| ||||||||| |||| ||||||||| |||||||||||||||||    
48551900 tgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaa 48551965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 463 - 537
Target Start/End: Original strand, 3353457 - 3353532
Alignment:
463 atttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||| ||||||||||| ||||||| | |||| ||||||||| |||| ||||||||| || ||||||||||||||    
3353457 atttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaa 3353532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 465 - 534
Target Start/End: Original strand, 1797495 - 1797565
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgc 534  Q
    |||| ||||||||||||||||||| | |||| ||| ||||| |||||||||||||| ||| ||||||||||    
1797495 ttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtgc 1797565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 17748456 - 17748383
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||||| |||| ||||||||| |||| ||||| | |||||||||||| ||||||    
17748456 ttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaa 17748383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 38578941 - 38578868
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| |||||||||  ||| ||||| | |||||||||||||||||||    
38578941 ttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 38578868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 439 - 504
Target Start/End: Original strand, 43925521 - 43925586
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagt 504  Q
    |||||||||| ||  ||||| || | |||||||||||||||| ||||||| |||||||||||||||    
43925521 ggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagt 43925586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 465 - 538
Target Start/End: Original strand, 18785704 - 18785778
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaag 538  Q
    |||| ||||||||||| ||||||| |||| ||||||||||| | || || || | ||||||||||||||||||||    
18785704 ttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcgaag 18785778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 537
Target Start/End: Complemental strand, 27875250 - 27875089
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   ||||| |||| |||| |||||||| ||||| ||| |||||||| ||  |||||||| | |||| ||||||    
27875250 aaccaagttgtttgggctccagtggcaagtagctccttcc-aagacgtatctggggaataccggattcgattcccagggggaataacacttggccagtgc 27875152  T
476 gcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
     |||| ||||||| |||||  | ||||||| |||| |||| |  ||||| |||||||||||||    
27875151 acatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaa 27875089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 452 - 537
Target Start/End: Original strand, 41945495 - 41945581
Alignment:
452 aagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||   |||| ||||||||||| ||||||| | |||| ||||||||| |||| ||||| || |||||||| |||||||||    
41945495 aagggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaa 41945581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 465 - 534
Target Start/End: Complemental strand, 45960077 - 45960007
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgc 534  Q
    |||||||||||||||| ||||||| || ||| |||||||||   || ||||||||| ||||||||||||||    
45960077 ttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttgatggatcggaaaccggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 27028314 - 27028387
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||  ||||||||||||||||   || ||||| | |||||||||||||||||||    
27028314 ttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaa 27028387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 10048009 - 10047877
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| || ||||| || ||||| ||| |||||||| ||  ||||| || | |||| ||||||||| | ||||||| |||||| | |||||||    
10048009 agctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtc 10047910  T
506 atccatctttgatgg-tcggaaaccggtgcgaa 537  Q
     |||| | ||| ||| |||||||||||||||||    
10047909 gtccaccattggtgggtcggaaaccggtgcgaa 10047877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Complemental strand, 44961707 - 44961639
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| |||||||||||||||| |||   ||||||| ||||  ||||||||| |||||||||||||||||    
44961707 cagtacgcatgtctctacgtacgagtcagattagttatccgcctttgatgggtcggaaaccggtgcgaa 44961639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 9e-16; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 5029827 - 5029926
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||||||  | ||| ||  ||||||||||||||||| ||||||| ||||| ||||||||||  ||||||||||| |||||||||| ||||||||    
5029827 ggttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcgaa 5029926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 413 - 537
Target Start/End: Original strand, 8932644 - 8932770
Alignment:
413 ttccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccat 511  Q
    |||||| |||||||| || ||||||||| |||||||| ||  ||||| || | ||||  |||||||||| ||||||| |||||| |||||| ||| |||     
8932644 ttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccac 8932743  T
512 ctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||||||| |||||||||||||||||    
8932744 ctttgatgggtcggaaaccggtgcgaa 8932770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 413 - 537
Target Start/End: Original strand, 8944110 - 8944236
Alignment:
413 ttccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccat 511  Q
    |||||| |||||||| || ||||||||| |||||||| ||  ||||| || | ||||  |||||||||| ||||||| |||||| |||||| ||| |||     
8944110 ttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccac 8944209  T
512 ctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||||||| |||||||||||||||||    
8944210 ctttgatgggtcggaaaccggtgcgaa 8944236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 8938658 - 8938820
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaata-tcggttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||||||   ||||| |||||||||  |||| || ||||| | |||||||||| ||   |||| || | |||  ||||||    
8938658 aaccaagttgtttgggctccagtgacaaggagctccttccaaagacatatccggggaatacttggttcgattcccaggaggaacaacacttgaccagtgc 8938757  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||| |  |||||| |||||| | ||||||| |||| ||||||| |||||||||||||||||||    
8938758 gcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaa 8938820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 455 - 520
Target Start/End: Complemental strand, 375058 - 374993
Alignment:
455 ggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    |||||||  ||||| ||||||||||| ||||| | ||||| ||||||||||||| |||||||||||    
375058 ggaataacgtttggccagtgcgcatgcctctatgcatgagttggattagtcatctatctttgatgg 374993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 6606230 - 6606098
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| || ||||| || ||||| ||| |||||||||||  ||||| || | |||| |||||  |||| ||||||| |||||| |||||||||    
6606230 agctccttccaaggacgtatccggggaataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtc 6606131  T
506 atccatctttgat-ggtcggaaaccggtgcgaa 537  Q
     |||| | ||| | |||||||||||||||||||    
6606130 gtccaccattggtgggtcggaaaccggtgcgaa 6606098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 439 - 537
Target Start/End: Complemental strand, 5253323 - 5253224
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||| ||||||||||| ||||||| |||||| |||||| ||  ||| ||||| | |||||||||||||||||||    
5253323 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaa 5253224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 470 - 520
Target Start/End: Complemental strand, 2271372 - 2271322
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    ||||||||||||||||||| | |||| ||||||||| |||| |||||||||    
2271372 cagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgg 2271322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 9633699 - 9633626
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| | |||| |||||||||  ||| ||||| | |||||||||||||||||||    
9633699 ttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 9633626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 21898684 - 21898757
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| | || |||| |  |||||||||||||||||||    
21898684 ttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaa 21898757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 29444839 - 29444766
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||  |||||||||| | ||||||||||  |||||||    
29444839 ttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggtgggtcggaaactagtgcgaa 29444766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 30788984 - 30788854
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| |||||||| || ||||||||| || ||||||||   |||| ||  ||||| ||||||||||| ||||| | | |||| |||||||||    
30788984 agctccttccaaggatgtatccggggaatatcgggtttgattctcat--ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtc 30788887  T
506 atccatctttgatgg-tcggaaaccggtgcgaa 537  Q
      ||| ||||| ||| |||||||||||||||||    
30788886 gcccacctttggtgggtcggaaaccggtgcgaa 30788854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 13036137 - 13036005
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| || ||||  || ||||||||| ||||||| |||  ||||| || | |||| ||||||||||| ||||||| ||||||  ||||||||    
13036137 agctccttccaaggacgtattcggggaatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtc 13036038  T
506 atcca-tctttgatggtcggaaaccggtgcgaa 537  Q
     |||| | || |  |||||||||||||||||||    
13036037 gtccactattggtgggtcggaaaccggtgcgaa 13036005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 30410486 - 30410554
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| ||||||||||||| ||   |||||||| | |||||||||||| ||||||    
30410486 cagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaa 30410554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 533
Target Start/End: Complemental strand, 32157236 - 32157172
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtg 533  Q
    ||||||||||  ||||||| ||||||  ||||||||||||||||||| ||| || ||||||||||    
32157236 cagtgcgcatacctctacgcatgagccagattagtcatccatctttggtggatcagaaaccggtg 32157172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 407 - 529
Target Start/End: Complemental strand, 34954752 - 34954628
Alignment:
407 agctcattccaaagatgtatctggagaatatc-ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| || ||| |||| ||||| | |||||||||||||  ||||| ||  ||||| |||||| |||  ||||||| ||||||  ||||||||    
34954752 agctccttccaaggacgtacctggggaataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtc 34954653  T
506 atccatctttgat-ggtcggaaacc 529  Q
     |||| ||||||| |||||||||||    
34954652 gtccacctttgatgggtcggaaacc 34954628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 9e-16; HSPs: 21)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 407 - 521
Target Start/End: Complemental strand, 14974457 - 14974342
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||||||| || || ||||| |||||||||||| ||||||||| || ||||| || |||||| |||||| |||| ||||||| |||||| |||||||||    
14974457 agctcattctaaggacgtatccggagaatatcgggttcgattctaaaggggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtc 14974358  T
506 atccatctttgatggt 521  Q
     |||| ||||| ||||    
14974357 gtccacctttggtggt 14974342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 423 - 533
Target Start/End: Original strand, 41800967 - 41801079
Alignment:
423 gtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-gg 520  Q
    |||||||| ||||||||| |||||||||||| ||||| ||   |||  || |||||||||||||||| | |||| ||||||||| | |||||||||| ||    
41800967 gtatctggggaatatcgggttcgattctcaaggggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgatggg 41801066  T
521 tcggaaaccggtg 533  Q
    ||||||| |||||    
41801067 tcggaaagcggtg 41801079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 42086365 - 42086433
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| |||||| ||||||||| |||| ||||| | |||||||||||||||||||    
42086365 cagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaa 42086433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 376 - 537
Target Start/End: Original strand, 20525781 - 20525944
Alignment:
376 aaaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtg 474  Q
    ||||||||||| ||||||| | ||| ||   ||||| || ||| |||||||| || ||||||||| |||||||| ||   |||| || | || | |||||    
20525781 aaaccaagttgcttgggctccagtggcaaggagctcctttcaaggatgtatccggggaatatcgggttcgattcccaggtggaacaacacttcgccagtg 20525880  T
475 cgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||| ||||||| |||||| ||||||||| |||| | ||| ||| |||||||||||||||||    
20525881 cgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaa 20525944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 502
Target Start/End: Complemental strand, 18136443 - 18136317
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatc-ggttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   ||||| ||||||||| ||||| |||||||| | |||||||||| ||  ||||| || | ||||||||||     
18136443 aaccaagttgtttgggctccagtggcaaggagctccttccaaagacgtatccggagaataccgggttcgattcccagggggaacaacacttggtcagtgt 18136344  T
476 gcatgtctctacgtatgagctggatta 502  Q
    ||||| ||||||  |||||| ||||||    
18136343 gcatgcctctacacatgagccggatta 18136317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 452 - 537
Target Start/End: Original strand, 21375371 - 21375457
Alignment:
452 aagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||||| || |||||  |||||||||||  |||||| |||||  ||||||||| |||||||||||||| ||||||||| |||||||    
21375371 aagggaacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaa 21375457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 476 - 537
Target Start/End: Complemental strand, 27648488 - 27648426
Alignment:
476 gcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||| |||||||||||||| ||||||||| |||||||||| ||| |||||||||| ||||||    
27648488 gcatgcctctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaa 27648426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 464 - 537
Target Start/End: Complemental strand, 41163535 - 41163461
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatc-tttgatggtcggaaaccggtgcgaa 537  Q
    ||||| |||||| |||||||||||| |||||||||||||||| |||| | ||||  |||||||||| ||||||||    
41163535 tttggccagtgcacatgtctctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaa 41163461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 9805037 - 9805110
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||| | |||||||||| ||||||||    
9805037 ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaa 9805110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 14728116 - 14728189
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||||||||| ||||||| |||||| ||||||||    || ||||||| |||||||||||||||||||    
14728116 ttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaa 14728189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 23383690 - 23383763
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| |||||||| || ||||||| |||||||||||||||| |||| ||||| | |||||||||| ||||||||    
23383690 ttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaa 23383763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 42291579 - 42291506
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| |||||| |||| ||||||| | |||| ||||||||| |||| ||||||||| |||||||||||||||||    
42291579 ttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaa 42291506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 1538438 - 1538537
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||| ||||||||||| ||||||| |||||| |||||| || |||| | ||| | |||||||||||||||||||    
1538438 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaa 1538537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 505
Target Start/End: Original strand, 22295238 - 22295289
Alignment:
454 gggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||||||||| |||| ||||||||||| ||||||| ||||| ||||||||||    
22295238 gggaataatacttggccagtgcgcatgcctctacgcatgagttggattagtc 22295289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 23247484 - 23247353
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||||||||||| || ||| |||| ||||||||| |||||||| ||   |||| ||   ||| |||||  ||||| ||||||| | ||||  ||||||||    
23247484 agctcattccaaggacgtacctggggaatatcgggttcgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtc 23247385  T
506 atccatctttgatggtcggaaaccggtgcgaa 537  Q
     |||| |||||||||||| |||||||||||||    
23247384 gtccacctttgatggtcgaaaaccggtgcgaa 23247353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 407 - 516
Target Start/End: Original strand, 24498957 - 24499066
Alignment:
407 agctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||| |||||| || |||||||||||||||||| ||||||| || |||  |||||   ||| |||||||||||| ||||||||| |||| |||||| |     
24498957 agctccttccaaggacgtatctggagaatatcgggttcgatt-tctaagaaaataacgcttgatcagtgcgcatgcctctacgtacgagccggattaata 24499055  T
506 atccatctttg 516  Q
     ||||||||||    
24499056 gtccatctttg 24499066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 5731994 - 5731921
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||||||||||  |||||||| | || |||| |  |||||||||||||||||||    
5731994 ttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaa 5731921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 43399161 - 43399234
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatcttt-gatggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| | |||| ||||||||| ||||  ||| | ||||||||||||||||||||    
43399161 ttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaa 43399234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 5079364 - 5079436
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatggtcggaaaccggtgcgaa 537  Q
    ||||||| ||||||||  |||||| | |||| |||||||||  ||| ||||| |||||| |||||||||||||    
5079364 ttggtcaatgcgcatgcttctacgcacgagccggattagtcgcccacctttggtggtcgaaaaccggtgcgaa 5079436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Complemental strand, 14588686 - 14588618
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| |||||| ||||||||| |||| ||||| || | || |||||||||||||    
14588686 cagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcgaa 14588618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 20255407 - 20255475
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||| ||||||| |||||  ||||||||| |||| ||||| || ||||||||| ||||||||    
20255407 cagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaa 20255475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 11)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 4479370 - 4479297
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||||||||||||| |||| ||||| | |||||||||||||||||||    
4479370 ttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaa 4479297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 473 - 537
Target Start/End: Original strand, 43027349 - 43027414
Alignment:
473 tgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||| ||||||| |||||| ||||||||| |||||||||||| |||||||||||| ||||||    
43027349 tgcgcatgcctctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaa 43027414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 465 - 532
Target Start/End: Complemental strand, 24938636 - 24938568
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggt 532  Q
    ||||||| |||||||| ||||||| |||| | |||||||||||||| ||||||||| ||||||||||||    
24938636 ttggtcaatgcgcatgcctctacgcatgaaccggattagtcatccacctttgatggatcggaaaccggt 24938568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 464 - 537
Target Start/End: Original strand, 993223 - 993297
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||| || |||||||||||||||||||||| |||||||||| |||| ||||| ||| || |||| |||||||||    
993223 tttggacaatgcgcatgtctctacgtatgagttggattagtcgtccacctttggtggttcagaaatcggtgcgaa 993297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 45521116 - 45521277
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||   || ||||||||| |||||| | || ||||| ||| |||||||| ||  ||||| || | ||| |||||||    
45521116 aaccaagttgcttgggctccagtggcaaggagttcattccaaggatgtacccggggaataccgggttcgattcccag-gggaacaacacttgatcagtgc 45521214  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| |||||| |||||||||   || ||||||| |||||||||||||||||||    
45521215 gcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaa 45521277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 441 - 516
Target Start/End: Original strand, 22958782 - 22958857
Alignment:
441 ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttg 516  Q
    ||||||| ||| |||||| |||  |||||||||| ||||||||||| | |||||| ||||||||| |||| |||||    
22958782 ttcgattttcagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacctttg 22958857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 470 - 505
Target Start/End: Original strand, 28333078 - 28333113
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||||||||||||||||||||||||||| |||||||    
28333078 cagtgcgcatgtctctacgtatgagctgaattagtc 28333113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 465 - 520
Target Start/End: Complemental strand, 35496329 - 35496274
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg 520  Q
    |||||||||||||||| ||||||||| ||||||||||| ||  ||| |||||||||    
35496329 ttggtcagtgcgcatgcctctacgtacgagctggattaatcgcccacctttgatgg 35496274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 2467192 - 2467119
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||||||||| | |||||| ||||||||| ||||   ||| || ||||||||||||||||||    
2467192 ttggccagtgcgcatgtctctatgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaa 2467119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 470 - 534
Target Start/End: Original strand, 18374051 - 18374116
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgc 534  Q
    ||||||||||| ||||||| |||||| ||||||||| |||| ||||| | ||||| ||||||||||    
18374051 cagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgc 18374116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 470 - 537
Target Start/End: Original strand, 36662445 - 36662513
Alignment:
470 cagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||||||||| |||||||||||| | ||||||||| ||||  ||| |||| |||||||||| ||||||    
36662445 cagtgcgcatgcctctacgtatgaaccggattagtcgtccacttttaatggatcggaaaccgatgcgaa 36662513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 41053 - 41152
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    |||||||||||||| ||||| || | |||||||||| ||||| ||||||| | |||| |||||||||  ||||||||| || ||||||||||||| ||||    
41053 ggttcgattctcaaggggaacaacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgcccatctttggtgagtcggaaaccggttcgaa 41152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 18)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 463 - 537
Target Start/End: Original strand, 2784962 - 2785037
Alignment:
463 atttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    |||||||||||||||||| ||||||| |||||   |||||||| |||||| |||||| ||||||||||||||||||    
2784962 atttggtcagtgcgcatgcctctacgcatgagtcagattagtcgtccatcattgatgagtcggaaaccggtgcgaa 2785037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 439 - 533
Target Start/End: Original strand, 37560179 - 37560274
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtg 533  Q
    |||||||||||||| ||||| ||  ||||||||||||||||| ||||||| | |||| |||||| || |||| ||||||| ||||| |||||||||    
37560179 ggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtg 37560274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 377 - 537
Target Start/End: Complemental strand, 14169772 - 14169610
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||||||   || || |||||| || ||||  || ||||||||| ||||||||||   ||||| || | |||  ||||||    
14169772 aaccaagttgtttgggctccagtgacaaggagatctttccaaggacgtattcggggaatatcgggttcgattctccgggggaacaacacttgaccagtgc 14169673  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||||||||||| |||||| ||||||||| || | | ||| | |||||||||||||||||||    
14169672 gcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaa 14169610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 407 - 537
Target Start/End: Complemental strand, 25540537 - 25540405
Alignment:
407 agctcattccaaagatgtatctggagaata-tcggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||||||||||| || |||||||| ||||| | ||||||||||  |  ||||| ||   |||| ||||||||||| ||||||| | |||| |||||||||    
25540537 agctcattccaaggacgtatctggggaatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtc 25540438  T
506 atccatctttgat-ggtcggaaaccggtgcgaa 537  Q
     |||| ||||| | |||||||||||||||||||    
25540437 gtccacctttggtgggtcggaaaccggtgcgaa 25540405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 12864167 - 12864329
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||||||   ||||| |||||| || ||||  || ||||| ||| |||||||  ||  ||||| || | |||||||||||    
12864167 aaccaagttgtttgggctccagtgacaaggagctccttccaatgacgtattcggggaataccggattcgatttccagggggaacaacacttggtcagtgc 12864266  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    ||||| |||| || ||||||  |||||||| |||| | ||| | |||||||||||||||||||    
12864267 gcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaa 12864329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 537
Target Start/End: Complemental strand, 19976970 - 19976808
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||| ||||||||||| | ||| ||   ||||| |||||| || ||||| || ||||| ||| ||||||| |||  ||||||||  ||||||||||||    
19976970 aaccaaattgtttgggctccagtggcaagtagctctttccaaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagtgc 19976871  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgatg-gtcggaaaccggtgcgaa 537  Q
    ||||||||||||| || ||  | |||||||  ||| ||||||||  ||||||| |||||||||    
19976870 gcatgtctctacgcataagtcgaattagtcgcccacctttgatgaatcggaaatcggtgcgaa 19976808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 432 - 537
Target Start/End: Original strand, 34722679 - 34722785
Alignment:
432 gaatatcggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccg 530  Q
    |||||| |||||||||||||  | ||| ||   ||||||||||| |||||||||||| | |||| |||||||||  ||| ||||||||| || |||||||    
34722679 gaatatgggttcgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccg 34722778  T
531 gtgcgaa 537  Q
    |||||||    
34722779 gtgcgaa 34722785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 3643961 - 3643888
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||||||||||||| |||| ||||| | || ||||||||| ||||||    
3643961 ttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaa 3643888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 473 - 537
Target Start/End: Complemental strand, 20116678 - 20116613
Alignment:
473 tgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||||||| ||||||| |||||| ||||||| | |||| ||||||||| |||||||||||||||||    
20116678 tgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaa 20116613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 441 - 533
Target Start/End: Complemental strand, 39201606 - 39201513
Alignment:
441 ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtg 533  Q
    |||||||||||  ||||| ||| ||||| ||||| ||||| ||||||| |||||| ||||||||| | || ||||| | |||||||||||||||    
39201606 ttcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 516
Target Start/End: Original strand, 24179568 - 24179651
Alignment:
432 gaatatcggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttg 516  Q
    ||||| ||||||||||||| | ||||| ||  ||||| |||||| |||| ||||||| |||||| ||||||||| ||||||||||    
24179568 gaataccggttcgattctc-aggggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttg 24179651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 465 - 505
Target Start/End: Complemental strand, 30721929 - 30721889
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    ||||||||||||||||||||||||||||||  |||||||||    
30721929 ttggtcagtgcgcatgtctctacgtatgagtcggattagtc 30721889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 8410074 - 8410236
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||| ||||||| | ||| ||   ||||| |||||| || ||| | |||||||||||| |||||||| ||  ||||| || | |||| ||||||    
8410074 aaccaagttgcttgggctccagtggcaaggagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgc 8410173  T
476 gcatgtctctacgtatgagctggattagtcatcca-tctttgatggtcggaaaccggtgcgaa 537  Q
    ||||| ||||||| | |||| |||||||||  ||| | || |  |||||||||||||||||||    
8410174 gcatgcctctacgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaa 8410236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 439 - 505
Target Start/End: Complemental strand, 10026716 - 10026650
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtc 505  Q
    |||||||||||||  ||||| ||  ||||| ||||||||||| ||||||| |||||| |||||||||    
10026716 ggttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtc 10026650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 377 - 537
Target Start/End: Original strand, 38005345 - 38005507
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaata-tcggttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||   ||||| |||||| || ||| | || ||||| | |||||||||| ||| ||||| ||   |||| ||||||    
38005345 aaccaagttgtttgggctccagtggcaaggagctccttccaaggacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgc 38005444  T
476 gcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    ||||| ||||||  |||||| |||||||||  ||| ||||| ||| |||||||| ||||||||    
38005445 gcatgcctctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaa 38005507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 505
Target Start/End: Complemental strand, 18649189 - 18649060
Alignment:
377 aaccaagttgtttgggcttccgtgacagtaagctcattccaaagatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgc 475  Q
    |||||||||||||||||| | ||| ||  |||||  |||||| |||| ||   | ||||| ||| |||||||||||   |||| ||||||||| ||||||    
18649189 aaccaagttgtttgggctccagtggcaagaagctgcttccaaggatgcattcagggaataccggattcgattctcaggaggaacaatatttgggcagtgc 18649090  T
476 gcatgtctctacgtatgagctggattagtc 505  Q
    ||||| ||||||| |||||  |||||||||    
18649089 gcatgcctctacgcatgagtcggattagtc 18649060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 22593166 - 22593238
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||| ||||||| |||||| ||||||||| |||| ||||| | |||||| ||||||||||||    
22593166 ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaa 22593238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 533
Target Start/End: Complemental strand, 28525529 - 28525460
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtg 533  Q
    |||| ||||||||||| ||||||| | |||| |||||||||||||| |||| || |||||||||| ||||    
28525529 ttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtg 28525460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 420 - 533
Target Start/End: Original strand, 186507 - 186621
Alignment:
420 gatgtatctggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatcttt-ga 517  Q
    ||||||| ||||||||||||| ||||||| |||  | ||||||| |||||||||||| |||| ||||||| | |||| ||||||||| | ||||||| |     
186507 gatgtatttggagaatatcgggttcgatt-tcagggagaataatgtttggtcagtgcacatgcctctacgcacgagccggattagtcgttcatctttagt 186605  T
518 tggtcggaaaccggtg 533  Q
     |||||||||||||||    
186606 gggtcggaaaccggtg 186621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 429 - 537
Target Start/End: Original strand, 224315 - 224425
Alignment:
429 ggagaatatcgg-ttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaa 526  Q
    |||||||||||| ||||| |||||  | ||||||  |||| ||||||| |||  ||||||| | |||| ||||||||| |||||||||| ||| ||||||    
224315 ggagaatatcgggttcgaatctcagggagaataacgtttgatcagtgcacatacctctacgcacgagccggattagtcgtccatctttggtgggtcggaa 224414  T
527 accggtgcgaa 537  Q
    |||||||||||    
224415 accggtgcgaa 224425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 8775 - 8702
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| |||||||| || ||||||| |||||||||||||||| |||| ||||| | |||||||||| ||||||||    
8775 ttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaa 8702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 42906 - 42833
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||||||||| ||||||  |||||| |||||||||  ||| ||||| | |||||||||||||||||||    
42906 ttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 42833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 465 - 537
Target Start/End: Complemental strand, 65226 - 65153
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||||||||||| ||||||||||||||||   ||  |||||| | |||||||||||||||||    
65226 ttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaa 65153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 439 - 537
Target Start/End: Original strand, 6864 - 6963
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||||||||| ||  ||||| || | |||| ||||||||||| ||||||| |||||| |||||||||   || ||||| | |||||||||||||||||||    
6864 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaa 6963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 464 - 534
Target Start/End: Original strand, 219403 - 219474
Alignment:
464 tttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgc 534  Q
    ||||| ||||||||||| ||||||| | || ||||||||||| |||| ||||||||| ||| ||||||||||    
219403 tttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgc 219474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 439 - 537
Target Start/End: Complemental strand, 7935 - 7836
Alignment:
439 ggttcgattctcaaagggaataatatttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgatgg-tcggaaaccggtgcgaa 537  Q
    |||| ||||| ||| ||||| || | |||| ||||||||||| ||||||| || |||||||||||||  ||| ||||| ||| |||||||||||| ||||    
7935 ggtttgattcccaaggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccacctttggtggatcggaaaccggtacgaa 7836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 319457 - 319530
Alignment:
465 ttggtcagtgcgcatgtctctacgtatgagctggattagtcatccatctttgat-ggtcggaaaccggtgcgaa 537  Q
    |||| ||||||||||  ||||| | |||||||||||||||| |||| ||||| | || ||||||||||||||||    
319457 ttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaa 319530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University