View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_high_92 (Length: 242)
Name: NF16569_high_92
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_high_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 125 - 220
Target Start/End: Original strand, 9783244 - 9783347
Alignment:
| Q |
125 |
gatggtagatacatatctaatcaaactttaaagtattatagtgttcactttt-------actcctttgtttaaacgatctttgtcattgttac-tacctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9783244 |
gatggtagatacatatctaatcaaactttaaagtattctagtgttcactattttcctcaactcctttgtttaaacgatctttgtcattgttacttacctc |
9783343 |
T |
|
| Q |
217 |
attt |
220 |
Q |
| |
|
|||| |
|
|
| T |
9783344 |
attt |
9783347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 9783133 - 9783161
Alignment:
| Q |
17 |
cataggcaaaatgtcatatgatgctctgt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9783133 |
cataggcaaaatgtcatatgatgctctgt |
9783161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University