View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_102 (Length: 245)
Name: NF16569_low_102
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_102 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 39784700 - 39784485
Alignment:
| Q |
17 |
tatataatagccagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagnnnnnnngaaaagatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39784700 |
tatataatagccagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagtttttttgaaaagatta |
39784601 |
T |
|
| Q |
117 |
aggaagagtttcttgctttttcttcagagatcttcttgttctgttgttttcttgttcagcagaaaattgtgatatatacttcaattcttacaaggttaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784600 |
aggaagagtttcttgctttttcttcagagatcttcttgttctgttgttttcttgttctgcagaaaattgtgatatatacttcaattcttacaaggttaga |
39784501 |
T |
|
| Q |
217 |
acctatatttcatttc |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39784500 |
acctatatttcatttc |
39784485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University