View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_103 (Length: 244)
Name: NF16569_low_103
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 84 - 225
Target Start/End: Complemental strand, 3771165 - 3771024
Alignment:
| Q |
84 |
tagtgtgtcttttgtcctgctctataaattagcaaacaatccatgccatttgcatcttccattttcaatcaaatggataatcctcactttcttgtcattc |
183 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
3771165 |
tagtgtgtcttttgacctgctctataaattagcaaacaatccatgccatttgcatcttccattttcaatcaaatgggtatccctcactttcttgttattc |
3771066 |
T |
 |
| Q |
184 |
catacccaatcccaggtcatataaatcctctcatgcaattat |
225 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
3771065 |
catacccaattccaggtcatataaatcccctcatgcaattat |
3771024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 225
Target Start/End: Complemental strand, 3783511 - 3783451
Alignment:
| Q |
165 |
cctcactttcttgtcattccatacccaatcccaggtcatataaatcctctcatgcaattat |
225 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||| | |||||||| |||||||||| |
|
|
| T |
3783511 |
cctcattttcttgttattccatacccaatagcaggtcatgtgaatcctcttatgcaattat |
3783451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University