View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_108 (Length: 240)
Name: NF16569_low_108
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_108 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 40515661 - 40515442
Alignment:
| Q |
18 |
atgttaaacaacta--gtagtagtaagtaaccatagccattccttctttcactctctccaaccgaccagtttggtttaattgaatgggatggaaatgaaa |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515661 |
atgttaaacaactatagtagtagtaagtaaccatagccattccttctttcactctctccaaccgaccagtttggtttaattgaatgggatggaaatgaaa |
40515562 |
T |
 |
| Q |
116 |
tgaaatgaaaactaaactaactcccctcggccctctctatatctgtattctgtttggcagtatgggtatgtatggctaatatggcccctacttatctgcc |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40515561 |
tgaaa-----actaaactaactcccctcggccctctctatatctgtattctgtttggcagtatgggtatgtatggctaatatggcccctacttatctgcc |
40515467 |
T |
 |
| Q |
216 |
ggacaaaaaacaaattctttaattt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40515466 |
ggacaaaaaacaaattctttaattt |
40515442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University