View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_110 (Length: 238)
Name: NF16569_low_110
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_110 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 89 - 222
Target Start/End: Original strand, 39386159 - 39386291
Alignment:
| Q |
89 |
taacaacgtgctagatttacaaataattgatttcatttacaaatgaagnnnnnnnntatactcaaatatttcctagttagaaattttttatttaatttat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39386159 |
taacaacgtgctagatttacaaataattgatttcatttacaaatgaa-aaaaaatatatactcaaatatttcttagttagaaattttttatttaatttat |
39386257 |
T |
|
| Q |
189 |
tatggnnnnnnnntactttcacaagagagatatt |
222 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
39386258 |
tatggaaaaaaaatactttcacaagagagatatt |
39386291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University