View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_112 (Length: 238)
Name: NF16569_low_112
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 73 - 223
Target Start/End: Complemental strand, 28529988 - 28529837
Alignment:
| Q |
73 |
acatactgcgttgcatggtattggttatcttggttaagggtttattctaaagattccaaataggttcttaatattcattcccacgcc-nnnnnnntgtga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28529988 |
acatactgcgttgcatggtattggttatcttggttaagggtttattctaaagattccaaataggttcttaatattcattcccacgccaaaaaaaatgtga |
28529889 |
T |
|
| Q |
172 |
aagaaattaagaaaagtttttcaaccttaatatcattatcaagctgaaaatt |
223 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28529888 |
aaggaattaagaaaagtttttcaaccttaatatcattatcaagctgaaaatt |
28529837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University