View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_114 (Length: 234)
Name: NF16569_low_114
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 41032420 - 41032616
Alignment:
| Q |
20 |
gtatgctatggtaatcatttgttatatattttgagctgtagccacattatttttaatgttttttgccttcgtaacttgcagcctgactctgaaacccagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41032420 |
gtatgctatggtaatcatttgttatatattttgagctgtagccacattatttttaatgttttttgccttcgtaacttgcagcctgactctgaaacccagc |
41032519 |
T |
 |
| Q |
120 |
ttttaacaattcagtttgaatggaatggtgttctaaagtctgtatcaagcactttggttggagtgagccctgaatttgaaattgctttgtataccct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41032520 |
ttttaacaattcagtttgaatggaatggtgttctaaagtctgtatcaagcactttggttggagtgagccctgaatttgaaattgctttgtataccct |
41032616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University