View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_117 (Length: 231)

Name: NF16569_low_117
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_117
NF16569_low_117
[»] chr3 (1 HSPs)
chr3 (20-191)||(39509272-39509443)
[»] scaffold0618 (1 HSPs)
scaffold0618 (21-135)||(2901-3015)
[»] chr2 (1 HSPs)
chr2 (21-135)||(29258571-29258685)
[»] chr8 (2 HSPs)
chr8 (33-125)||(25989317-25989409)
chr8 (22-135)||(37110939-37111053)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 39509443 - 39509272
Alignment:
20 cgaatctcattgggtgtcttttgttaattgttgtatcttcaattggaacttcaagttattagctaacggtgagcatggatagattgaatgcacaattttt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39509443 cgaatctcattgggtgtcttttgttaattgttgtatcttcaattgaaacttcaagttattagctaacggtgagcatggatagattgaatgcacaattttt 39509344  T
120 gttccattgtggttttcaggactggcattgtgttccaatggaaaataagtcgaaaatatggagatttgtcaa 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | || ||| ||||||||||||||||    
39509343 gttccattgtggttttcaggactggcattgtgttccaatggaaaatcattctaaattatggagatttgtcaa 39509272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 135
Target Start/End: Original strand, 2901 - 3015
Alignment:
21 gaatctcattgggtgtcttttgttaattgttgtatcttcaattggaacttcaagttattagctaacggtgagcatggatagattgaatgcacaatttttg 120  Q
    ||||||||||| ||| |||||||||||||||||||| || |||| |||||| ||||||| ||||||  ||| ||||||||||||||||||||||||||||    
2901 gaatctcattgtgtgccttttgttaattgttgtatcatccattgaaacttcgagttattggctaacaatgaacatggatagattgaatgcacaatttttg 3000  T
121 ttccattgtggtttt 135  Q
    |||||||||||||||    
3001 ttccattgtggtttt 3015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 135
Target Start/End: Original strand, 29258571 - 29258685
Alignment:
21 gaatctcattgggtgtcttttgttaattgttgtatcttcaattggaacttcaagttattagctaacggtgagcatggatagattgaatgcacaatttttg 120  Q
    ||||||||||| ||| |||||||||||||||||||| || |||| |||||| ||||||| ||||||  ||| ||||||||||||||||||||||||||||    
29258571 gaatctcattgtgtgccttttgttaattgttgtatcatccattgaaacttcgagttattggctaacaatgaacatggatagattgaatgcacaatttttg 29258670  T
121 ttccattgtggtttt 135  Q
    |||||||||||||||    
29258671 ttccattgtggtttt 29258685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 125
Target Start/End: Original strand, 25989317 - 25989409
Alignment:
33 gtgtcttttgttaattgttgtatcttcaattggaacttcaagttattagctaacggtgagcatggatagattgaatgcacaatttttgttcca 125  Q
    ||||||||| |||||||||||||||||||||||| ||||| ||| || |||||| | |||||||  |||||    ||||||||||||||||||    
25989317 gtgtcttttcttaattgttgtatcttcaattggagcttcaggttgttggctaacagggagcatgtctagataaggtgcacaatttttgttcca 25989409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 135
Target Start/End: Complemental strand, 37111053 - 37110939
Alignment:
22 aatctcattgggtgtcttttgttaattgttgtatcttcaattggaacttcaagttattag-ctaacggtgagcatggatagattgaatgcacaatttttg 120  Q
    |||||||||| ||||||| |||| ||| ||| |||||||||||||  ||||  || || | ||||| |||||||||||| ||||| || | |||| ||||    
37111053 aatctcattgtgtgtcttgtgttgattattggatcttcaattggactttcagcttcttgggctaacagtgagcatggatggattggatacgcaatctttg 37110954  T
121 ttccattgtggtttt 135  Q
    |||||||||||||||    
37110953 ttccattgtggtttt 37110939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University