View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_119 (Length: 223)
Name: NF16569_low_119
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_119 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 37204120 - 37204322
Alignment:
| Q |
1 |
aattggtttttcagaaagattggatggatgcatttatggattgagtctaattcacaactcattgttcaagcatacaagaattatagccgttgggttaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37204120 |
aattggtttttcagaaagattggatggatgcatttatggattgagtctaattcacaactcattgttcaagcatacaagaattatagccgttgggttaatg |
37204219 |
T |
 |
| Q |
101 |
catccaacttagatatatgaacttta-nnnnnnnactctttaaagagggcgatcatttgtgctaatttaatggctctgctctaaaagtgcattttaatgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37204220 |
catccaacttagatatatgaactttattttttttactctttaaagagggcgatcatttgtgctaacttaatggctctgctctaaaagtgcattttaatgg |
37204319 |
T |
 |
| Q |
200 |
tct |
202 |
Q |
| |
|
||| |
|
|
| T |
37204320 |
tct |
37204322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University