View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_124 (Length: 216)
Name: NF16569_low_124
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_124 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 3964937 - 3964807
Alignment:
| Q |
18 |
ttagcaacacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgttgtaaagatgatcagtca |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3964937 |
ttagcagcacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgttgtaaagatgatcagtca |
3964838 |
T |
|
| Q |
118 |
ccacccttttctttttctcatcatctccata |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
3964837 |
ccacccttttccttttctcatcatctccata |
3964807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University