View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_127 (Length: 210)
Name: NF16569_low_127
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_127 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 5 - 194
Target Start/End: Original strand, 36875663 - 36875852
Alignment:
| Q |
5 |
gcataataataatactcaatacaataattttaaaaataattggaaaagctgaaattattattgataatgtgatattaacaacgatatactacatccattt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36875663 |
gcataataataatactcaatacaataattttaaaaataattggaaaagccgaaactattattgataatgtgatattaacaacgatatactacacccattt |
36875762 |
T |
 |
| Q |
105 |
aggtagatttaatggtgttgacttgagagactttagaatgtgttcattttaaggtctcaaatttgaagtttaatttcttcaaaaattaat |
194 |
Q |
| |
|
|| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36875763 |
agattaatttagtggtgttgacttgagagactttagaatgtgttcattttaaggtctcaaatttgaagtttaacttcttcaaaaattaat |
36875852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University