View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_16 (Length: 544)
Name: NF16569_low_16
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 283 - 526
Target Start/End: Original strand, 43540949 - 43541192
Alignment:
| Q |
283 |
tggttgaagttaaggccaatgagttttttaatacttctttttggactcgtatggcgaaggataaaatggcgattaatggaattggagtgcnnnnnnncgt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43540949 |
tggttgaagttaaggccaatgagttttttaatactactatttggactcgtatggcgaaggataaaatggcgattaatggaattggagtgctttttttcgt |
43541048 |
T |
 |
| Q |
383 |
gattttttacagaactgtggtggttagctataagaagcagaagaaggattatgaagataggattaagattcagaaagctgatgcggaagagagaaggaag |
482 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541049 |
gattttttacagaactgtggtggttagctataagaagcagaagaaggattacgaagataggattaagattcagaaagctgatgcggaagagagaaggaag |
43541148 |
T |
 |
| Q |
483 |
atgagggagatggaagccgagatggggtggagtgaagctggcgg |
526 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43541149 |
atgagggagatggaagccgagatggggtggagtgaagctggcgg |
43541192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 43540683 - 43540822
Alignment:
| Q |
17 |
accactttcggtattggcgaggatttggttgtctctgccatttcacaagcctttggttgactttgttaataggtttcagccgaagaaaaagtcgaagaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540683 |
accactttcggtattggcgaggatttggttgtctctgccatttcacaagcctttggttgagtttgttaataggtttcagccgaagaaaaagtcgaagaag |
43540782 |
T |
 |
| Q |
117 |
gagttggcgttgagggaagctaggatgcagttgcagaggc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540783 |
gagttggcgttgagggaagctaggatgcagttgcagaggc |
43540822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University