View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_50 (Length: 354)
Name: NF16569_low_50
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 344
Target Start/End: Complemental strand, 43808274 - 43807949
Alignment:
| Q |
19 |
ctatatttcttcttattgctgattttccattctgatttgttttagggtgccattatgcacattgttttgctttgatttttgcttttcatatatgctgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43808274 |
ctatatttcttcttattgctgatttttcattctgatttgttttagggtgccattatgcacattgttttgctttgatttttgcttttcatatatgctgaaa |
43808175 |
T |
 |
| Q |
119 |
tatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43808174 |
tatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggt |
43808075 |
T |
 |
| Q |
219 |
cgactttgtatgagtattgcaagattggtgggatgtggaagcgtttcattgatgctcgcaatatttttgaaggtgtgaggatgaggattggtgctccggt |
318 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
43808074 |
cgactctgtatgagtattgcaagattggtgggatgtgaaagcgtttcattgatgctcgcaatatttttgaaggtgtgaggatgagcattggtgctctggt |
43807975 |
T |
 |
| Q |
319 |
ggttgataacaacaccactgcctatg |
344 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
43807974 |
ggttgataacaacaccactgtctatg |
43807949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 110 - 337
Target Start/End: Original strand, 38507406 - 38507633
Alignment:
| Q |
110 |
atgctgaaatatgaaggacgatgtgaggagattattgacagggctgccgcaaccgtgaaactgggggatgactgtggaaatgcttgggactgtgttttga |
209 |
Q |
| |
|
||||| |||||||||||||| | || || ||||| ||| ||||||| ||||||||||||||| |||||||| || ||||| |||||||||||||||| |
|
|
| T |
38507406 |
atgctcaaatatgaaggacgcgttcagcaggttattaacatggctgccacaaccgtgaaactggtggatgactatgaaaatgagtgggactgtgttttga |
38507505 |
T |
 |
| Q |
210 |
tgtttgggtcgactttgtatgagtattgcaagattggtgggatgtggaagcgtttcattgatgctcgcaatatttttgaaggtgtgaggatgaggattgg |
309 |
Q |
| |
|
||||||| | |||| ||||||| | |||||||||||||||| ||||||||||| ||||||||| ||| ||||||||||||||||||| | |||| | |
|
|
| T |
38507506 |
tgtttggattgactccgtatgagcactgcaagattggtgggagctggaagcgttttgttgatgctcacaaattttttgaaggtgtgaggattatgatttg |
38507605 |
T |
 |
| Q |
310 |
tgctccggtggttgataacaacaccact |
337 |
Q |
| |
|
|| | |||||||| |||||| ||||| |
|
|
| T |
38507606 |
cgcccaggtggttggaaacaactccact |
38507633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 48539555 - 48539613
Alignment:
| Q |
165 |
tgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggtcgact |
223 |
Q |
| |
|
||||| ||| |||||| ||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
48539555 |
tgaaaatggtggatgattgtggaaattgttgggactgtgttttgatctttggctcgact |
48539613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 165 - 223
Target Start/End: Complemental strand, 13066257 - 13066199
Alignment:
| Q |
165 |
tgaaactgggggatgactgtggaaatgcttgggactgtgttttgatgtttgggtcgact |
223 |
Q |
| |
|
||||| ||| |||||| ||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
13066257 |
tgaaaatggtggatgattgtggaaattgttgggactgtgttttgatctttggctcgact |
13066199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 83
Target Start/End: Complemental strand, 37147899 - 37147832
Alignment:
| Q |
19 |
ctatatttcttcttattgctgattttccattc---tgatttgttttagggtgccattatgcacattgt |
83 |
Q |
| |
|
||||||||||||||||| |||||||| |||| | ||| |||||||||||||||||||||||||| |
|
|
| T |
37147899 |
ctatatttcttcttatttctgattttttattctcttttttttttttagggtgccattatgcacattgt |
37147832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University