View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_56 (Length: 340)
Name: NF16569_low_56
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 2131081 - 2131305
Alignment:
| Q |
14 |
cacagactatactcgcatgcaaggtgtgcgcatcttaggcctccttcacttgacatgttcacttttgacttgcaattgggacttgagacaagattctcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131081 |
cacagactatactcgcatgcaaggtgtgcgcatcttaggcctccttcacttgacatgttcacttttgacttgcaattgggacttgagacaagattctcct |
2131180 |
T |
 |
| Q |
114 |
aaattttatggacttcatatctttgttgtgattttcttcatacttttataacattcacaggacatcttttgatcagatcaaactattggtctataccaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131181 |
aaattttatggacttcatatctttgttgtgattttcttcatacttttataacattcacaggacatcttttgatcagatcaaactattggtctataccaaa |
2131280 |
T |
 |
| Q |
214 |
aagactaagacaccatatagagttg |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2131281 |
aagactaagacaccatatagagttg |
2131305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 266 - 334
Target Start/End: Original strand, 2131296 - 2131364
Alignment:
| Q |
266 |
tatagagttgtctggttatggaaatacatgactcaattcaaaatattatagactctttttctaaactat |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2131296 |
tatagagttgtctggttatggaaatacatgactcaattcaaaatattatagactctttttctagactat |
2131364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University