View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16569_low_58 (Length: 335)
Name: NF16569_low_58
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16569_low_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 7561560 - 7561461
Alignment:
| Q |
9 |
agatgaagaaagcgcaaaaccaaaaatttcctcctatcttgtctaatcctattgagaagaaactatttgaactttctcacgtgatttgaggacaagacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7561560 |
agatgaagaaagcgcaaaaccaaaaatttcctcctatcttgtctaatcctattgagaagaaactatttgaactttctcacgtgatttgaggacaagacaa |
7561461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 224 - 319
Target Start/End: Complemental strand, 7561274 - 7561179
Alignment:
| Q |
224 |
gagagggtagagttggatagaaagttgaacatgtattttaggaatttatgaacctttttaggttgaaaatgtatggaccactttttggaatatatg |
319 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7561274 |
gagagggtcgagttggatagaaagttgaacatgtattttaggaatttatgaacctttttaggttgaaaatgtatggaccactttttggaatatatg |
7561179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 108 - 187
Target Start/End: Complemental strand, 7561420 - 7561341
Alignment:
| Q |
108 |
aagaaaccaccggtggtaccagaagtgctagtttttgttgttgttgataatgaggagtctgcaaatattgataaaatggg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7561420 |
aagaaaccaccggtggtaccagaagtgctagtttttgttgttgttgataatgaggagtctgcaaatattgataaaatggg |
7561341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University