View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_74 (Length: 306)

Name: NF16569_low_74
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_74
NF16569_low_74
[»] chr1 (1 HSPs)
chr1 (1-306)||(18569914-18570219)


Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 18570219 - 18569914
Alignment:
1 gatgatccttggaagatcaagaaggtgctccaagaggatgatattgttgataagctattgttggacaaagatttggtagaggaattggtgttgcctgtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18570219 gatgatccttggaagatcaagaaggtgctccaagaggatgatattgttgataagctattgttggacaaagatttggtagaggaattggtgttgcctgtgt 18570120  T
101 tgagtgctggtgctgatcttgaaaaaggagctttggttaggatttttgattatgacaccgaatccatgcatgttctggttcataagagatgtgtttcttc 200  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
18570119 tgagtgctggtgctgatcttgaaagaggagctttggttaggatttttgattatgacactgaatccatgcatgttctggttcataagagatgtgtttcttc 18570020  T
201 aggaaactatggtttctttgacaattggttctatgattttgttagaagaaggggattaaagaaaggagatgaaattggcttccattgggatccatatatg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18570019 aggaaactatggtttctttgacaattggttctatgattttgttagaagaaggggattaaagaaaggagatgaaattggcttccattgggatccatatatg 18569920  T
301 aaacac 306  Q
    ||||||    
18569919 aaacac 18569914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University