View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16569_low_92 (Length: 256)

Name: NF16569_low_92
Description: NF16569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16569_low_92
NF16569_low_92
[»] chr3 (1 HSPs)
chr3 (44-241)||(10368146-10368343)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 44 - 241
Target Start/End: Complemental strand, 10368343 - 10368146
Alignment:
44 taaaatttcaatgtgaatttattctaacagatgatgtaaaagactccaacaaaataaaactatcttatcattgcttactgatcatgtgcactgatttcaa 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
10368343 taaaatttcaatgtgaatttattctaacagatgatgtaaaagactccaacaaaataaaactatcttatcattgcttactgatcatgtgcattgatttcaa 10368244  T
144 tgctattgggtcgggtgcaagtgaatcgaattcgaaactgtatcgaaatccaacggctttcagtccatgtatgatccacaagatgaagctcaaataat 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10368243 tgctattgggtcgggtgcaagtgaatcgaattcgaaactgtatcgaaatccaacggctttcagtccatgtatgatccacaagatgaagctcaaataat 10368146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University