View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16570_low_14 (Length: 205)
Name: NF16570_low_14
Description: NF16570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16570_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 20068137 - 20068315
Alignment:
| Q |
13 |
attatactaggaggaacgacaacccacatctttctacttattatcaaggtctatatagtcgggtttaaagtagaaagagccatggtcgatcaaagcagta |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
20068137 |
attatactaggaggaatgacaacccacatctttctacttattatcacgatctatatagtcgggtttaaagtaataagagtcatggtcgatcaaagcagta |
20068236 |
T |
 |
| Q |
113 |
gctacgatgtcatgttgtcaacttgttcaaaaccttgtagcagcccatccagtgccttcgacctacaacatgataaaac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068237 |
gctacgatgtcatgttgtcaacttgttcaaaaccttgtagcagcccatccagtgccttcgacctacaacatgataaaac |
20068315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University