View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16570_low_9 (Length: 303)

Name: NF16570_low_9
Description: NF16570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16570_low_9
NF16570_low_9
[»] chr1 (1 HSPs)
chr1 (219-285)||(40290145-40290208)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 219 - 285
Target Start/End: Original strand, 40290145 - 40290208
Alignment:
219 ttaaacaacacacatatagaaacattgtgagcacttaccacatgagatacaaaattatctcttaatt 285  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||    
40290145 ttaaacaacacacatatagaaacattgtgagcacttaccacatgagatac---attatctcttaatt 40290208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University