View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_14 (Length: 304)
Name: NF16571_high_14
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 55076045 - 55075953
Alignment:
| Q |
19 |
atgtttatccaatttcgttttcaagagtcatttctaatgctaattaggtatgtatgactgtgttacacgtattttgatccagacattatataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076045 |
atgtttatccaatttcgttttcaagagtgatttctaatgctaattaggtatgtatgactgtgttacacgtattttgatccagacattatataa |
55075953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University