View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_15 (Length: 299)
Name: NF16571_high_15
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 86 - 283
Target Start/End: Complemental strand, 2512533 - 2512336
Alignment:
| Q |
86 |
gtaacagatcgtaagattaaagaatcttgcttatgataagtcgtttgtcgatgtttgaataaaatggttccttttatgtttgaatattgcttatgagaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2512533 |
gtaacagatcgtaagattaaagaatcttgcttatgataagtcgtttgtcgatgtttgaataaaatggttccttttatgtttgaatattgcttatgagaaa |
2512434 |
T |
|
| Q |
186 |
tattaaatccgaagttttattgttcatgacttaattcaaaagtgattcttttatagttttagagatttgaaaacatcaactttatgtggtaagcttca |
283 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2512433 |
tattaaatccgaagttttattgtttatgacttaattcaaaagtgattcttttatagttttagagatttgaaaacatcaactttgtgtgggaagcttca |
2512336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 180 - 257
Target Start/End: Complemental strand, 2509110 - 2509036
Alignment:
| Q |
180 |
gagaaatattaaatccgaagttttattgttcatgacttaattcaaaagtgattctttt-atagttttagagatttgaaa |
257 |
Q |
| |
|
|||||||||||||| | || |||||||||| ||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2509110 |
gagaaatattaaatgcaaaattttattgtttatgactt----caaaagtgatcctttttatagttttagagatttgaaa |
2509036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University