View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_16 (Length: 277)
Name: NF16571_high_16
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 69 - 165
Target Start/End: Complemental strand, 4097821 - 4097725
Alignment:
| Q |
69 |
gactaagcatatggttgataccatcgtttttcattccaccatatttcagtggtttatgtggccaattatttctttggactgacccaatcaatagtgt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4097821 |
gactaagcatatggttgataccatcgtttttcattccaccagatttcagtggtttatgtggccaattatttctttggactgacccaatcaatagtgt |
4097725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 4097657 - 4097582
Alignment:
| Q |
186 |
caattttacattatcttcttcgaactgaattaaatgagttgatgcctcatgtctctgcctccctaaagcaagtaac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4097657 |
caattttacattatcttcttcgaactgaattaaatgagttgatgcctcatgtctctgcctccctaaagcaagtaac |
4097582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 4097852 - 4097808
Alignment:
| Q |
11 |
cataggaatgtaagagaacaatagttttcatgactaagcatatgg |
55 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4097852 |
cataagaatgtaagtgaacaatagttttcatgactaagcatatgg |
4097808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University