View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_20 (Length: 250)
Name: NF16571_high_20
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 51781243 - 51781007
Alignment:
| Q |
14 |
atatgtttataaatggggttagtttcacctt-aaacccaattttataaggatttattaagtcaaatatnnnnnnnnttaatattatatcagaatttattt |
112 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
51781243 |
atatgtttataaatgaggttagtttcacctttaaacccaattttataaggatgtattaagttatatataaaaaaa-ttaatattatatcagaatttattc |
51781145 |
T |
|
| Q |
113 |
aagatcaattagacaatacgttaccaagtcacgagttctacactaaggaatatatgttggacaatgtttttataagtatgggcacgagccaaaccaggtt |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51781144 |
aagatcaattagacaatatgttaccaagtcacgagttctacactaaggaatatatgttggacaatgtctttataagtatgggcacgagccaaaccaggtt |
51781045 |
T |
|
| Q |
213 |
atagccaggatgggttgtcgccacccgaaaggaaagaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51781044 |
atagccaggatgggttgtcgccaccccaaaggaaagaa |
51781007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University