View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_27 (Length: 232)
Name: NF16571_high_27
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 43797205 - 43797006
Alignment:
| Q |
15 |
aatatctactcttgcttatctactaccatggcttttgaatttcctctgctttagacacaagtagaatttgacttcnnnnnnngtcgctgaatctgaacat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
43797205 |
aatatctactcttgcttatctactaccatggcttttgaatttcctctgctttagacacaagtagaatttgagttctttttttgtcactgaatctgaacat |
43797106 |
T |
 |
| Q |
115 |
agaatattcacaatcccttcccctcctccattttgtgatttttaaaagcactgttctctgcatgacagagtcctttgataaaattttgcagggatcgttt |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797105 |
agaatatttacaatcccttcccctcctccattttgtgattttt-aaagcactgttctctgcatgacagagtcctttgataaaattttgcagggatcgttt |
43797007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University