View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_high_28 (Length: 227)
Name: NF16571_high_28
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_high_28 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 227
Target Start/End: Original strand, 32464254 - 32464478
Alignment:
| Q |
3 |
atttcaaatggattcgacctgactcagagtgggatccaattacgttaaactacacctccggaacgacttcgtctccgaaaggtgtagtgcattgtcatag |
102 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32464254 |
atttcaaatggattcaacctaactcagagtgggatcctattacgttaaactacacctccggaacgacttcatctccgaaaggtgtagtgcattgtcatag |
32464353 |
T |
 |
| Q |
103 |
agcaacgttcattgtttcccttgattcactcgttgattggtcagttccggttcaaccagttttcttgtggacattgccgatgtttcattctaatggatgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32464354 |
agcaacgttcattgtttcccttgattcactcgttgattggtcagttccggttcaaccggttttcttgtggacattgcctatgtttcattctaatggatgg |
32464453 |
T |
 |
| Q |
203 |
agctacccgtgggcaatggctgcag |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32464454 |
agctacccgtgggcaatggctgcag |
32464478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32456883 - 32456657
Alignment:
| Q |
1 |
atatttcaaatggattcgacctgactcagagtgggatccaattacgttaaactacacctccggaacgacttcgtctccgaaaggtgtagtgcattgtcat |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32456883 |
atatttcaaatggatccgacctgactcagagtgggatccaattacgttaaactacacctccggaacgacgtcgtctccgaaaggtgtagtgcattgtcac |
32456784 |
T |
 |
| Q |
101 |
agagcaacgttcattgtttcccttgattcactcgttgattggtcagttccggttcaaccagttttcttgtggacattgccgatgtttcattctaatggat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||| |||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32456783 |
agagcaacgttcattgtttctcttgattctctcattgactggtcagttccggttcaaccggttttcttgtggacattaccgatgtttcattctaatggat |
32456684 |
T |
 |
| Q |
201 |
ggagctacccgtgggcaatggctgcag |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32456683 |
ggagctacccgtgggcaatggctgcag |
32456657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 23684 - 23906
Alignment:
| Q |
3 |
atttcaaatggattcgacctgactcagagtgggatccaattacgttaaactacacctccggaacgacttcgtctccgaaaggtgtagtgcattgtcatag |
102 |
Q |
| |
|
||||||||||||| || || ||| | |||||||||||||||||| | ||||||||||||||||| || |||||||| |||||||| ||||||||||| || |
|
|
| T |
23684 |
atttcaaatggatccgtcccgacaccgagtgggatccaattacgctgaactacacctccggaacaacgtcgtctccaaaaggtgttgtgcattgtcacag |
23783 |
T |
 |
| Q |
103 |
agcaacgttcattgtttcccttgattcactcgttgattggtcagttccggttcaaccagttttcttgtggacattgccgatgtttcattctaatggatgg |
202 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||| || |||||||||||||||||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
23784 |
agcaacgttcattgtttcacttgattctctcattgattggtcggtaccggttcaaccagttttcttgtggacgttgcaaatgtttcattctaacggatgg |
23883 |
T |
 |
| Q |
203 |
agctacccgtgggcaatggctgc |
225 |
Q |
| |
|
||||| ||||||| ||||||||| |
|
|
| T |
23884 |
agctatccgtggggaatggctgc |
23906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University