View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_13 (Length: 404)
Name: NF16571_low_13
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 14 - 66
Target Start/End: Complemental strand, 30338821 - 30338769
Alignment:
| Q |
14 |
aagaatatacgtttgatctatttagttaagtaaataagaaaaatacatcaatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30338821 |
aagaatatacgtttgatctatttagttaactaaataagaaaaatacatcaatt |
30338769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University