View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_29 (Length: 285)
Name: NF16571_low_29
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 23 - 275
Target Start/End: Complemental strand, 50137015 - 50136761
Alignment:
| Q |
23 |
cttctaaaccctaaaccctaaactcaccaaagagaattttagaactct--gttactgactaactattttgcttctctctctcgtcctctttggaaccgag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
50137015 |
cttctaaaccctaaaccctaaactcaccaaagagaattttagaactctctgttactgactaacttctctgcttctctctctcgtcctctttggaaccgag |
50136916 |
T |
|
| Q |
121 |
agtctcgtgcgcggtttctctgcaactcgcattttgcttgaaaaagtgagtttcaatcgctgtttatatcagtatttcttcaactcattttatcaatttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50136915 |
agtctcgtgcgcggtttctctgcaactcgcattttgcttgaaaaagtgagtttcaatcgctgtttatatcagtatttcttcaacccattttatcaatttg |
50136816 |
T |
|
| Q |
221 |
ttagttgttgcataccaacattgaaatcaaatactgcatttaatagctgattcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50136815 |
ttagttgttgcataccaacattgaaatcaaatactgcatttaatagctgattcat |
50136761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 9806491 - 9806430
Alignment:
| Q |
187 |
tatcagtatttcttcaactcattttatcaatttgttagttgttgcataccaacattgaaatc |
248 |
Q |
| |
|
||||||||||| || |||||||| ||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
9806491 |
tatcagtattttctctactcatttgatcaaattgttagttgtagcataccaatattgaaatc |
9806430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University