View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_32 (Length: 275)
Name: NF16571_low_32
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 259
Target Start/End: Original strand, 40207383 - 40207630
Alignment:
| Q |
12 |
atgaagtaacctatgaaagtagtactattactctctcttgcctgtgtattttctatggatctttctattgttaacaaagaaaggataatagtagcaataa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207383 |
atgaagtaacctatgaaagtagtactattactctctcttgcctttgtattttctatggatctttctattgttaacaaagaaaggataatagtagcaataa |
40207482 |
T |
|
| Q |
112 |
cacgtgtgataacaattggaatatcactagctcatttatgccaacatattgtaactaattaagatctcacaattgttacaagcttctttgtattttcctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207483 |
cacgtgtgataacaattggaatatcacaagctcatttatgccaacatattgtaactaattaagatctcacaattgttacaagcttctttgtattttcctt |
40207582 |
T |
|
| Q |
212 |
ggatctttctacaaaggataatagtggcggcagcatgtgtcaataaac |
259 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207583 |
ggatcttactataaaggataatagtggcggcagcatgtgtcaataaac |
40207630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University