View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_35 (Length: 258)
Name: NF16571_low_35
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 34039062 - 34038841
Alignment:
| Q |
16 |
atgaatgtgaagggaataatgggtgatgatagtgcaagaaacatgaagtggatggttaaggaaactaatagtgattcaacaacatccattggaacattct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039062 |
atgaatgtgaagggaataatgggtgatgatagtgcaagaaacatgaagtggatggttaagaaaactaatagtgattcaacaacatccattggaacattct |
34038963 |
T |
|
| Q |
116 |
cagaagattcaaataattctatgtgttcttgttcatctgatttgactgaggatgctgattcttcttcttcatcatcacattcaaatggatcattatgtga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
34038962 |
cagaagattcaaataattctatgtgttcttgttcatctgatttgactgaggatgctgattctt---cttcatcatcacattcaataggatcattatgtga |
34038866 |
T |
|
| Q |
216 |
tttttcagagctcatgaacaatctt |
240 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
34038865 |
tttctcagagctcatgaacaatctt |
34038841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University