View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_37 (Length: 249)
Name: NF16571_low_37
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 1191473 - 1191232
Alignment:
| Q |
1 |
aatttatgaaaagtctatttaatttattaaaaaacaattgcaggctaccctacaatttggatttagattatggtgcactctctcaacttcaacaccttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1191473 |
aatttatgaaaagtctatttaatttattaaaaaacaattgcaggctaccctacaatttggatttagattatggtgcactctctcaacttcatcaccttgg |
1191374 |
T |
 |
| Q |
101 |
agattcatttgttgaagaattatgctcttctcttaacacaaaacactcgcgcctaacggaattgataattatatttctatgtgaattaagtgacttaagt |
200 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1191373 |
agatccatttgttgaagaattctgctcttctcttaacacaaaacactcgcggctaacgaaattgataattatatttctatgtgaattaagtgacttaagt |
1191274 |
T |
 |
| Q |
201 |
cactctaaaacaaaaaaccattcacatcttcttcttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1191273 |
cactctaaaacaaaaaaccattcacatcttcttcttcatctc |
1191232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 1303377 - 1303302
Alignment:
| Q |
17 |
atttaatttattaaaaaacaattgcaggctaccc-tacaatttggatttagattatggtgcactctctcaacttca |
91 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
1303377 |
atttaatttatgaaaaatctattgcaggctacccctacaatttggatttcgattatggcgcactctctcaacttca |
1303302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 26676282 - 26676207
Alignment:
| Q |
17 |
atttaatttattaaaaaacaattgcaggctaccc-tacaatttggatttagattatggtgcactctctcaacttca |
91 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
26676282 |
atttaatttatgaaaaatctattgcaggctacccctacaatttggatttcgattatggcgcactctctcaacttca |
26676207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 26677462 - 26677387
Alignment:
| Q |
17 |
atttaatttattaaaaaacaattgcaggctaccc-tacaatttggatttagattatggtgcactctctcaacttca |
91 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
26677462 |
atttaatttatgaaaaatctattgcaggctacccctacaatttggatttcgattatggcgcactctctcaacttca |
26677387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University