View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_39 (Length: 245)
Name: NF16571_low_39
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_39 |
 | |
|
| [»] scaffold0008 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0008 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 69476 - 69254
Alignment:
| Q |
5 |
catatgatctcacatattttaggttttcatctagttgtctcttgagattcttgaaccttaaaatatcttcggttgagtttgaccacatagaagtatctat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
69476 |
catatgatctcacatattttaggttttcatctagttgtctcttgagattcttgaaccttaaaatatcttcggttgagtttgaccacatagaagtatctat |
69377 |
T |
|
| Q |
105 |
acgaaacttctcaatgttttggttctctttcctcacatttctcatcttatatttgtcgaaagaattgtctagttggctcatatcttggattttctctaaa |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
69376 |
acgaaacttctcaatgtgttggttctctttcctcacatttctcatcttatatttgtcgaaagaattgtctagttggctcagattttggatcttctctaaa |
69277 |
T |
|
| Q |
205 |
caattatacgtagctccccccac |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
69276 |
caattatacgtagctccccccac |
69254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 77319 - 77097
Alignment:
| Q |
5 |
catatgatctcacatattttaggttttcatctagttgtctcttgagattcttgaaccttaaaatatcttcggttgagtttgaccacatagaagtatctat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77319 |
catatgatctcacatattttaggttttcatctagttgtctcttgagattcttgaaccttaaaatatcttcggttgagtttgaccacatagaagtatctat |
77220 |
T |
|
| Q |
105 |
acgaaacttctcaatgttttggttctctttcctcacatttctcatcttatatttgtcgaaagaattgtctagttggctcatatcttggattttctctaaa |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
77219 |
acgaaacttctcaatgtgttggttctctttcctcacatttctcatcttatatttgtcgaaagaattgtctagttggctcagattttggatcttctctaaa |
77120 |
T |
|
| Q |
205 |
caattatacgtagctccccccac |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
77119 |
caattatacgtagctccccccac |
77097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University