View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16571_low_46 (Length: 227)
Name: NF16571_low_46
Description: NF16571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16571_low_46 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 32958794 - 32959013
Alignment:
| Q |
9 |
attatactcatcaccttgaacatttaaataaccaaacagctacaaaacattcaaccatgtaaacattatcaaatacccaagataatcaaaatgtggattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958794 |
attatactcatcaccttgaacatttaaataaccaaacagctacaaaacattcaaccatgtaaacattatcaaatacccaagataatcaaaatgtggattg |
32958893 |
T |
|
| Q |
109 |
gggat--cacacttatacnnnnnnnnncataatcaaatccactatagtttatcatcatcaacataaccaagatttccaactaatctcatcaccacaaacc |
206 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958894 |
gggatcacacacttatac-aacaaaaacataatcaaatccaccatagtttatcatcatcaacataaccaagatttccaactaatctcatcaccacaaacc |
32958992 |
T |
|
| Q |
207 |
aacaaccccaataaaatcaaa |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32958993 |
aacaaccccaataaaatcaaa |
32959013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University