View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_high_18 (Length: 296)
Name: NF16572_high_18
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 76 - 286
Target Start/End: Original strand, 3820760 - 3820970
Alignment:
| Q |
76 |
cacgtaaagctgattttaagcattcattatatcttatgcatggttctaattttcactttttatttcttattataataaataaatatagaatannnnnnna |
175 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3820760 |
cacgtaaggctgattttaagcattcattatatcttatgcatggttctaattttcactttttatttcttattataataaataaatatagaatattttttta |
3820859 |
T |
 |
| Q |
176 |
caaattgtaaatcaacaatgatatttagacatcattaacttttgaacatccaatcaactcttcattctctctctcctcttacgacttttcaacattcaat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3820860 |
caaattgtaaatcaacaatgatatttagacatcattaacttttgaacatccaatcaactcttcattctctctctcctcttacgacttttcaacattcaat |
3820959 |
T |
 |
| Q |
276 |
caactcttcat |
286 |
Q |
| |
|
||||||||||| |
|
|
| T |
3820960 |
caactcttcat |
3820970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 3820943 - 3820980
Alignment:
| Q |
213 |
acttttgaacatccaatcaactcttcattctctctctc |
250 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
3820943 |
acttttcaacattcaatcaactcttcattctctctctc |
3820980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University