View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_high_21 (Length: 266)
Name: NF16572_high_21
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 7594200 - 7593952
Alignment:
| Q |
1 |
tgtggaaaaggagtatgcatcgtctcgatgccactgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgggaggatcatgtgctcgcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7594200 |
tgtggaaaaggagtatgcatcgtctcgatgccaccgaaacgcaccttaggagtggttcacacactagtaaggaagtgtgggaggatcatgtgcttgcaaa |
7594101 |
T |
 |
| Q |
101 |
aagtcttgtgatactctacaactttctctatggtgaaacacacgcccgctctagaattttgtcgccaactaatgtaattgccaacttttctgcaccacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594100 |
aagtcttgtgatactctacaactttctctatggtgaaacacacgcccactctagaattttgtcgccaactaatgtaattgccaacttttctgcaccaccg |
7594001 |
T |
 |
| Q |
201 |
cagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594000 |
cagtcgctggcattgcctgctgttgcggcggcaatccgttagaggtggt |
7593952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University