View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16572_high_25 (Length: 251)
Name: NF16572_high_25
Description: NF16572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16572_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 16158652 - 16158819
Alignment:
| Q |
1 |
ttgaatgaaattaaattgttgatggttgttaatctcttgactagatgttgttggcttgatgactggtatatcaaatgagagggagtatattagagatggc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16158652 |
ttgaatgaaattaaattgctgatggttggtaatctgttgactagatgttgttggcttaatgactggtatatcaaatgagagggagtatattagagatggc |
16158751 |
T |
|
| Q |
101 |
aaggttaccaagatggttgtttttcaactaactaatgataggtaagtgcacctttcatattgtttgaa |
168 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
16158752 |
aaggtgaccaagatggttgtttttcaactcactgatgataggtaagtgcacctttcatattggttgaa |
16158819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 120
Target Start/End: Complemental strand, 17491362 - 17491299
Alignment:
| Q |
57 |
tgatgactggtatatcaaatgagagggagtatattagagatggcaaggttaccaagatggttgt |
120 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| ||||| || |||||| |||| |
|
|
| T |
17491362 |
tgatgactggtatatccgctgagagggagtatattagggatgggaaggtgacaaagatgattgt |
17491299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University